Skip to main content
. 2015 Feb 20;10(2):e0117115. doi: 10.1371/journal.pone.0117115

Table 1. Primers used in this study.

Name Sequence(5’-3’) Purpose
sreA-a ATTTGAACTACAAAGACTTCTC PCR primers used to amplify the DNA fragment of sreA.
sreA-b TACCACTCTCGGAAGAACCTATG PCR primers used to amplify the DNA fragment of sreA.
sreA-c GCCGGTCTGATGGTTCTTGAAGG PCR primers used to amplify the DNA fragment of sreA.
sreA-d TCCAATGAGAGAAAGCTGGACTGG PCR primers used to amplify the DNA fragment of sreA.
sreA-e ACACGAGGCCTAAGTTTTGTTGCTG PCR primers used to amplify the 5’ unknown DNA sequence of sreA.
sreA-f ATCAAGCCGACCGGAAGATTAGGC PCR primers used to amplify the 5’ unknown DNA sequence of sreA.
sreA-g TTGATCTCCTTCCGAGAACATGGGC PCR primers used to amplify the 5’ unknown DNA sequence of sreA.
sreA-h ATACTGGGCCCGAAATGCCTACACC PCR primers used to amplify the 3’ unknown DNA sequence of sreA.
sreA-i TAAGAAATACAGGACCCGTCGACGC PCR primers used to amplify the 3’ unknown DNA sequence of sreA.
sreA-1 CCCTCGAGATGTCTGGCCCCAATATGGAG PCR primers used to amplify 5’ fragments of sreA.
sreA-2 GGACTAGTCAGCAAAGACTCCATGGTTTGC PCR primers used to amplify 5’ fragments of sreA.
sreA-3 CGAGCTCTTTCGAAGCAAGCGAGAAGG PCR primers used to amplify 3’ fragments of sreA.
sreA-4 GGGGTACCTCAGGCAGGGACATTTTGCA PCR primers used to amplify 3’ fragments of sreA.
sreA-F ATGGATGTCTGGCCCCAATATGGAG PCR primers used to amplify the ORF of sreA gene.
sreA-R TCAGGCAGGGACATTTTGCAC PCR primers used to amplify the ORF of sreA gene.
sreA-F1 GGACTAGTGGCAATAGTGGAGACTA GCAC PCR primers used to amplify sreA, including its promoter and terminator.
sreA-R1 GGACTAGTCTGATAACATTCCATTTCCC PCR primers used to amplify sreA, including its promoter and terminator.
cyp51A-F CACTGGATTCCTTTCATTGGG PCR primers used to amplify cyp51A gene by quantitative real-time PCR.
cyp51A-R TCCGAAGACGGGGGTTGTAA PCR primers used to amplify cyp51A gene by quantitative real-time PCR.
cyp51B-F GAGTTCATCCTCAATGGCAAGC PCR primers used to amplify cyp51B gene by quantitative real-time PCR.
cyp51B-R CTTAGAGTTGGGGCAATCGTAGAC PCR primers used to amplify cyp51B gene by quantitative real-time PCR.
cyp51C-F TGTTCAAGCAGCCATTCAAGC PCR primers used to amplify cyp51C gene by quantitative real-time PCR.
cyp51C-R CAAGTTGGGTCCGACGAAATA PCR primers used to amplify cyp51C gene by quantitative real-time PCR.
β-actin-F TGTCACCAACTGGGACGATA PCR primers used to amplify β-actin gene by quantitative real-time PCR.
β-actin-R GAGCTTCGGTCAAGAGGATG PCR primers used to amplify β-actin gene by quantitative real-time PCR.

Note: The underlined sequences represent different restriction enzyme sites.