Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers of PDGF-B in the reaction system.
| Primer | Length (bp) | Position | Tm (°C) | GC content (%) | Sequence |
|---|---|---|---|---|---|
| Left | 20 | 1515–1534 | 60 | 55 | CTGGCATGCAAGTGTGAGAC |
| Right | 19 | 1603–1621 | 60 | 53 | CGAATGGTCACCCGAGTTT |
Tm, melting temperature; GC, guanine-cytosine; PDGF, platelet-derived growth factor.
