Skip to main content
. 2015 Jan 28;(95):52032. doi: 10.3791/52032
Name of Reagent/Material/Equipment Company Catalog Number Comments
GAPDH-Forward Primer IDT Inc. Seq given in comments GTGGACCTGACCTGCCGTCT
GAPDH-Reverse Primer IDT Inc. Seq given in comments GGAGGAGTGGGTGTCGCTGT
CK7-Forward Primer IDT Inc. Seq given in comments TGGTGCTGAAGAAGGATGTG
CK7-Reverse Primer IDT Inc. Seq given in comments CACGCTGGTTCTTGATGTTG
Up-Ia-Forward Primer IDT Inc. Seq given in comments ACGTCCTACACCCACCGTGA
Up-Ia-Reverse Primer IDT Inc. Seq given in comments ACCCCACGTGTAGCTGTCGAT
Up-IIIa-Forward Primer IDT Inc. Seq given in comments ACAAACAGAGGGTGGGAGGA CAG
Up-IIIa-Reverse Primer IDT Inc. Seq given in comments AGAAGGGCAGGGAGCCCAGG
αSMA-Forward Primer IDT Inc. Seq given in comments ACCCACAATGTCCCCATCTA
αSMA-Reverse Primer IDT Inc. Seq given in comments TGATCCACATCTGCTGGAAG
Oct3/4 (Exogenous)-Forward Primer* IDT Inc. *Life Tech-Cytotune kit CCCGAAAGAGAAAGCGAACCAG
Oct3/4 (Exogenous)-Reverse Primer* IDT Inc. *Life Tech-Cytotune kit AATGTATCGAAGGTGCTCAA
Sox2 (Exogenous)-Forward Primer* IDT Inc. *Life Tech-Cytotune kit ATGCACCGCTACGACGTGAG CGC
Sox2 (Exogenous)-Reverse Primer* IDT Inc. *Life Tech-Cytotune kit AATGTATCGAAGGTGCTCAA
Klf4 (Exogenous)-Forward Primer* IDT Inc. *Life Tech-Cytotune kit TTCCTGCATGCCAGAGGAGCCC
Klf4 (Exogenous)-Reverse Primer* IDT Inc. *Life Tech-Cytotune kit AATGTATCGAAGGTGCTCAA
cMyc (Exogenous)-Forward Primer* IDT Inc. *Life Tech-Cytotune kit TAACTGACTAGCAGGCTTGTCG
cMyc (Exogenous)-Reverse Primer* IDT Inc. *Life Tech-Cytotune kit TCCACATACAGTCCTGGATGAT GATG
SeV (Exogenous)-Forward Primer* IDT Inc. *Life Tech-Cytotune kit GGATCACTAGGTGATATCGAGC
SeV (Exogenous)-Reverse Primer* IDT Inc. *Life Tech-Cytotune kit ACCAGACAAGAGTTTAAGAGA TATGTATC
Oct3/4 (Endogenous)-Forward Primer IDT Inc. Seq given in comments CAGTGCCCGAAACCCACAC
Oct3/4 (Endogenous)-Reverse Primer IDT Inc. Seq given in comments GGAGACCCAGCAGCCTCAAA
Sox2 (Endogenous)-Forward Primer IDT Inc. Seq given in comments CAAGATGCACAACTCGGAGA
Sox2 (Endogenous)-Reverse Primer IDT Inc. Seq given in comments GTTCATGTGCGCGTAACTGT
Dystrophin-Forward Primer IDT Inc. Seq given in comments GGCAAAAACTGCCAAAAGAA
Dystrophin-Reverse Primer IDT Inc. Seq given in comments GACCTGCCAGTGGAGGATTA