Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Gene | Forward Primer | Reverse Primer | Probe number | Probe cat# | Probe sequence |
|---|---|---|---|---|---|
| GTPCH1 | gctgtagcaatcacggaagc | cacctcgcattaccatacaca | 67 | 4688660001 | tgctggag |
| GAPDH | agccacatcgctcagacac | gcccaatacgaccaaatcc | 60 | 4688589001 | tggggaag |
| HPRT1 | tgaccttgatttattttgcatacc | cgagcaagacgttcagtcct | 73 | 4688961001 | gctgagga |
