Fig 1. Trypanosome GAPDH interacts with telomeric DNA.

(A) Oligos are labeled ss TTAGGG (ss) or ds TTAGGG (ds), both of which contain six tandem sequence repeat copies. They were incubated in the presence (+) or absence (-) of recombinant T. cruzi GAPDH. Samples were then analyzed by EMSA. (B) Labeled ss-TTAGGG containing six tandem sequence repeat copies were incubated with recombinant T. cruzi GAPDH only, or with both GAPDH and anti-GAPDH serum. The samples were analyzed by EMSA. (C) Labeled ss (TTAGGG)₆ oligos were incubated in the presence (+) or absence (-) of an anti-GAPDH serum. The samples were subsequently analyzed by EMSA. (D) and (E) Labeled ss-TTAGGG containing 6 tandem sequence repeat copies were incubated with recombinant T. cruzi GAPDH in the presence of increasing concentrations (1, 10 and 100X, in relation to the labeled telomeric oligonucleotide) of an non-specific unlabeled competitor (GCGGCCGCATGGACAGAGATTCACTTGTGG) (D) or the presence of cold ss-(TTAGGG)₆ (E). (F) and (G) The amount of complexes representing the telomere-GAPDH complex in D (F) or E (G) was estimated by ImageJ software. The graphs show the mean and standard deviation of three independent experiments. (H) Labeled ss-TTAGGG containing only one repeat unit or containing three or six tandem repeat sequences were incubated with 50 μM recombinant T. cruzi GAPDH and were analyzed by EMSA.