The Levels of Brachyspira hyodysenteriae Binding to Porcine Colonic Mucins Differ between Individuals, and Binding Is Increased to Mucins from Infected Pigs with De Novo MUC5AC Synthesis

Abstract

Brachyspira hyodysenteriae colonizes the pig colon, resulting in mucohemorrhagic diarrhea and growth retardation. Fecal mucus is a characteristic feature of swine dysentery; therefore, we investigated how the mucin environment changes in the colon during infection with B. hyodysenteriae and how these changes affect this bacterium's interaction with mucins. We isolated and characterized mucins, the main component of mucus, from the colon of experimentally inoculated and control pigs and investigated B. hyodysenteriae binding to these mucins. Fluorescence microscopy revealed a massive mucus induction and disorganized mucus structure in the colon of pigs with swine dysentery. Quantitative PCR (qPCR) and antibody detection demonstrated that the mucus composition of pigs with swine dysentery was characterized by de novo expression of MUC5AC and increased expression of MUC2 in the colon. Mucins from the colon of inoculated and control pigs were isolated by two steps of isopycnic density gradient centrifugation. The mucin densities of control and inoculated pigs were similar, whereas the mucin quantity was 5-fold higher during infection. The level of B. hyodysenteriae binding to mucins differed between pigs, and there was increased binding to soluble mucins isolated from pigs with swine dysentery. The ability of B. hyodysenteriae to bind, measured in relation to the total mucin contents of mucus in sick versus healthy pigs, increased 7-fold during infection. Together, the results indicate that B. hyodysenteriae binds to carbohydrate structures on the mucins as these differ between individuals. Furthermore, B. hyodysenteriae infection induces changes to the mucus niche which substantially increase the amount of B. hyodysenteriae binding sites in the mucus.

INTRODUCTION

The gastrointestinal tract is lubricated by a continuously secreted mucus layer which can also act as a barrier against pathogens (1). The main components of the mucus layer are heavily glycosylated gel-forming mucins. Mucin glycans can prevent enzymatic degradation of the mucin protein core and can also bind water, conferring viscoelasticity (2). Beneath the mucus layer, transmembrane mucins on the mucosal epithelial cells provide barrier and reporting functions (3, 4). Mucins differ in their glycosylation and tissue distribution (5). Murine colonic mucus has been shown to be rich in the MUC2 mucin, which is secreted by goblet cells and is organized in a two-layered mucus system (6). The inner mucus layer is firmly attached to the epithelium and gives rise to the loosely adherent outer layer (7).

Mucins are a dynamic component of the mucosal barrier and have been shown to undergo changes in response to intestinal infection and inflammation in mice (8, 9). Mucin glycan structures can bind bacteria, e.g., Escherichia coli and Helicobacter pylori, limiting colonization and access to the epithelial surface (3, 10–13). Mucin glycosylation can change during bacterial infection and differs between individuals (14). To date, it is unknown whether the large variability in mucin expression and mucin glycosylation arose by chance during evolution or whether the mucin species confer distinct response properties during infection.

Brachyspira hyodysenteriae is a recognized swine pathogen, commonly associated with swine dysentery (SD). This anaerobic spirochete colonizes the large intestine of pigs, resulting in mucohemorrhagic diarrhea. Ingestion of feces from inoculated pigs, as well as from asymptomatic carriers, is among the main sources of infection (15). SD is responsible for economic losses in the swine industry, posing a threat in countries where antimicrobials are banned for growth promotion and a challenge where resistant strains have emerged (16–19). The presence of mucus in the feces is a characteristic feature of SD. Recently, colonic specimens from pigs with SD were shown to have increased immunohistochemical staining with an antibody against the human MUC5AC mucin and decreased staining with an antibody against the MUC4 mucin (20).

B. hyodysenteriae pathogenesis is still surrounded by many uncertainties. The mechanisms underlying the bacterial interactions with the colonic mucosal surface and how the mucin response exerted during infection is regulated remain to be elucidated. Therefore, the overall aims of the present study were to investigate how the mucin environment changes in the swine colon during infection with B. hyodysenteriae, whether this bacterium binds to mucins, and, if so, how these changes affect binding. We found that B. hyodysenteriae infection causes changes in mucus organization and in the quantity, identity, and expression profile of mucin as well as in the mucin-binding ability of this bacterium.

MATERIALS AND METHODS

Ethics statement.

The animal experiments were approved by the ethical committee of the Faculty of Veterinary Medicine, Ghent University (EC2012/01 and EC2013/147), and complied with all ethical and husbandry regulations.

Experimental inoculation and sample collection.

Samples from a total of 15 pigs (Danish Large White × Piétrain) from two independent inoculation experiments, conducted 21 months apart, were included in the study (Table 1). The first experiment included 6 control pigs and 6 inoculated pigs and the second 8 control pigs and 8 inoculated pigs. The pigs from both inoculation experiments were 6 weeks old, came from two different commercial farrowing-to-finishing farms in the Flanders region with no history of swine dysentery, belonged to different litters, and were fed the same commercial starter feed (Lambers-Seghers, Belgium) (crude protein, 17%; crude fat, 6.09%; crude fiber, 3.87%; crude ash, 5.09%; phosphorus, 0.49%; methionine, 0.43%; lysine, 1.25%; calcium, 0.61%; sodium, 0.23%). At their arrival, the pigs were confirmed negative for B. hyodysenteriae in rectal fecal samples by culture and quantitative PCR (qPCR). The pigs were acclimatized for 2 weeks in order to recover from transport stress and adapt to diet and housing changes. The pigs were fed twice per day and had ad libitum access to water. A total of 14 pigs were experimentally inoculated with B. hyodysenteriae strain 8dII, isolated from a Belgian swine farm with a history of recent dysentery problems. An inoculum of 10⁸ CFU/ml in brain heart infusion (BHI) broth (50 ml/pig) was administered orally during three consecutive days, while 14 control pigs received 50 ml of sterile BHI broth. From the 14 control pigs, 6 samples (pigs A to F) were randomly selected for use in this study. Two of six pigs from the first infection trial developed SD, and three of eight pigs from the second infection trial developed SD (pigs 1 to 5). Samples from the four inoculated pigs that did not develop SD in the first inoculation experiment (pigs 6 to 9) were included in the study (Table 1).

TABLE 1.

Experimental design and data from B. hyodysenteriae-inoculated and control pigs^a

Treatment group and pig ID(s) (expt no.)	Sample(s) analyzedb	Start of clinical signs (dpi)	No. of days from start of clinical signs to necropsy	Clinical signs at day of necropsy	B. hyodysenteriae in feces the day of necropsy	Macroscopic signs of SD at necropsy	Histological signs of SD at necropsy
Inoculated with B. hyodysenteriae
1 (2)	Yes	39	1	Yes	Yes	Yes	Yes
2 (2)	Yes	29	11	Yes	Yes	Yes	Yes
3 (1)	Yes	12	28	Noc	Yes	Yes	Yes
4 (1)	Yes	15	25	Yes	Yes	Yes	Yes
5 (2)	Yes	29	11	Yes	Yes	Yes	Yes
6 (1)	Yes	No SD	NA	No	No	No	No
7 (1)	Yes	No SD	NA	No	No	No	No
8 (1)	Yes	No SD	NA	No	No	No	No
9 (1)	Yes	No SD	NA	No	No	No	No
10–14 (1, 2)	No	No SD	NA	No	No	No	No
Controls
A–F (1, 2)	Yes	NA	NA	No	No	No	No
G–N (1, 2)	No	NA	NA	No	No	No	No

^aID, identifier; expt no., 1st infection trial (1) or 2nd infection trial (2) or both (1, 2); dpi, days postinoculation; SD, swine dysentery, NA, not applicable.

^bInoculated pigs without clinical signs of SD and control pigs were randomly selected to match the number of pigs with clinical signs of SD.

^cPig 3 presented clinical signs of mucoid hemorrhagic diarrhea before sacrifice and severe necrotic lesions in the colon at necropsy.

Infection was confirmed based on clinical signs of mucohemorrhagic diarrhea, and B. hyodysenteriae excretion in feces was detected by qPCR in fecal samples obtained twice a week. The pigs were sacrificed at day 40 postinoculation by anesthesia with a combination of xylazine (Xyl-M; VMD, Arendonk, Belgium) (2%; 4.4 mg/kg of body weight) and zolazepam-tiletamine (Zoletil 100; Virbac, Carros, France) (2.2 mg/kg), and the final euthanasia procedure was performed by intracardial injection of a formulation comprising embutramide, mebezonium iodide, and tetracaine (T61; Intervet, Brussels, Belgium) at 0.3 ml/kg.

Midsection samples of the spiral colon with a size of 7 by 8 cm were obtained from the inoculated and control pigs for mucin isolation. Fecal material was removed, and the tissues were rinsed with phosphate-buffered saline (PBS) and a protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany) before snap-freezing and storage at −80°C. Smaller specimens were carefully collected without disturbing the mucus layer (no washing), immersed in 10 volumes of fresh Carnoy's methanol fixative (60% dry methanol, 30% chloroform, 10% glacial acetic acid), and embedded in wax for histology-immunohistochemistry. There were also samples collected in RNAlater (Life Technologies, Carlsbad, CA, USA) and kept at 4°C overnight and then stored at −80°C for RNA extraction.

Detection of B. hyodysenteriae in feces by qPCR.

DNA from pig feces was obtained by using a QIAamp DNA stool minikit (Qiagen, CA, USA), starting from 1 g of feces. For qPCR, Brachyspira-specific primers were used in combination with a B. hyodysenteriae-specific probe as previously described (21).

MUC2 and MUC5AC immunofluorescence.

Tissue sections were deparaffinized, and antigen retrieval was performed using 10 mM sodium citrate (pH 6.0) at 99°C for 30 min. Slides were cooled to room temperature and washed in PBS. Nonspecific background was blocked with a serum-free protein block (Dako, Carpinteria, CA, USA) for 20 min. Primary antibodies anti-MUC2C3 (kindly provided by G. Hansson, University of Gothenburg, Gothenburg, Sweden), anti-MUC5AC (45M1; Sigma-Aldrich, St. Louis, MO, USA), and anti-MUC5CR (kindly provided by G. Hansson, University of Gothenburg, Gothenburg, Sweden) were diluted 1/1,000 and incubated at 4°C overnight. Sections were washed with PBS and incubated with secondary antibodies conjugated with Alexa Fluor 488 (Life Technologies, Eugene, OR, USA) for MUC2 and Alexa Fluor 594 for MUC5AC, diluted 1/500 for 1 h. After washes in PBS, specimens were mounted with ProLong antifade containing DAPI (4′,6-diamidino-2-phenylindole) (Life Technologies, Eugene, OR, USA). Pig and human gastric specimens were used as positive controls for MUC5AC staining. Similarities in the stomach and colon binding patterns indicated that the staining of pig sections was specific, even though the antibodies were raised against human mucins.

qPCR for mucin expression.

Pig colon tissue samples were immediately submerged in a 10-fold volume of RNAlater (Life Technologies, Carlsbad, CA, USA) at 4°C overnight and frozen at −80°C until RNA extraction. Isolation of RNA was performed using TRIzol (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA yield and purity were assessed through UV spectroscopy (NanoDrop; Thermo Scientific, MA, USA). Total RNA (5 μg) was DNase treated at 37°C for 45 min, followed by the addition of 5 mM EDTA and heat inactivation of DNase at 75°C for 10 min prior to cDNA synthesis. MgCl₂ was added to achieve a 5 mM final concentration, and this RNA was used for cDNA synthesis with random hexamers and Superscript III (Life Technologies, Carlsbad, CA, USA) at 50°C for 2 h. The cDNA was used in a real-time PCR using SYBR green (Power SYBR green mix; Life Technologies, Carlsbad, CA, USA) and the primers listed in Table 2. The primers for pig MUC1, MUC2, and MUC5AC mucin genes were designed using the Primer3 program (available at http://frodo.wi.mit.edu/primer3/). qPCR data were normalized using the expression levels of ACTB and RPL4 reference genes (22). Samples were amplified in triplicate, and a negative control without reverse transcriptase was included to verify the absence of contaminating genomic DNA. Data acquisition and analysis were performed using CFX manager 3.1 software (Bio-Rad Laboratories Inc., Hercules, CA, USA).

TABLE 2.

List of primers used in qPCR

Target	Direction	Sequence (5′–3′)	Source or reference
MUC1	Forward	TCCGACCCGGGATGCCTACCA	This study
	Reverse	GGCTGCCCCCACCGTTGCCT	This study
MUC2	Forward	CCTTGCTCTCGTGTGGAACA	This study
	Reverse	ACTTCTCCTCGGGCTTGTTG	This study
MUC5AC	Forward	TGCGCCGTGCCACGCGGAGAT	This study
	Reverse	GCGGGGCAGGGGAAGGGGCA	This study
ACTB	Forward	CACGCCATCCTGCGTCTGGA	22
	Reverse	AGCACCGTGTTGGCGTAGAG	22
RPL4	Forward	CAAGAGTAACTACAACCTTC	22
	Reverse	GAACTCTACGATGAATCTTC	22

Mucin isolation and purification.

Mucin isolation of colon tissue samples was performed by isopycnic density gradient centrifugation as previously described (23), obtaining guanidinium hydrochloride (GuHCl)-soluble and “insoluble” mucins. Briefly, frozen tissues were drenched with 10 mM sodium phosphate buffer (pH 6.5) containing 0.1 mM phenylmethylsulfonyl fluoride (AppliChem, Darmstadt, Germany). Once thawed, the mucosal surfaces were scraped with a microscope slide, dispersed with a Dounce homogenizer, and stirred slowly overnight at 4°C in ice-cold extraction buffer consisting of 6 M GuHCl (AppliChem, Darmstadt, Germany), 5 mM EDTA (Sigma-Aldrich, St. Louis, MO, USA), 5 mM N-ethylmaleimide (Alfa Aesar, Karlsruhe, Germany), and 10 mM sodium dihydrogen phosphate at pH 6.5. GuHCl-soluble mucins were obtained after centrifugation at 23,000 × g for 50 min at 4°C, and the remaining material was reextracted twice by stirring overnight at 4°C in extraction buffer. The remaining pellets contained the insoluble mucins, which were solubilized with 10 mM dithiothreitol (DTT) in reduction buffer (6 M GuHCl, 5 mM EDTA, 0.1 M Tris-HCl, pH 8) for 5 h at 37°C. Finally, residues were alkylated overnight with 25 mM iodoacetamide (IAA; Alfa Aesar, Karlsruhe, Germany).

Both the GuHCl-soluble material and the insoluble material were dialyzed in 10 volumes of extraction buffer at 4°C, changing the dialysis solution three times in 24 h. An isopycnic density gradient centrifugation using cesium chloride (CsCl)–4 M GuHCl with a starting density of 1.39 g/ml was performed at 40,000 rpm for 90 h. The mucin-containing fractions were pooled and further purified from DNA by the use of a second gradient in CsCl–0.5 M GuHCl. Approximately 25 mucin fractions were recovered per sample using a fraction collector equipped with a drop counter. Fractions were stored at 4°C until further analysis.

Analysis of mucin fractions.

The first and second CsCl gradient mucin fractions were analyzed as follows. The mucin density was determined by weighing a known volume using a Carlsberg pipette as a pycnometer; results were expressed as g/ml. Levels of DNA contamination of mucins were determined using a spectrophotometer. A microtiter-based assay detecting carbohydrates as periodate-oxidizable structures (24) was performed in order to determine the glycan content in the GuHCl-soluble and insoluble mucin samples. Briefly, Nunc 96-well plates (Thermo Scientific, Waltham, MA, USA) were coated overnight at 4°C with mucin fractions diluted in 4 M and 0.5 M GuHCl. Plates were incubated with a 25 mM sodium (meta)periodate solution diluted in sodium acetate (NaAc) for 20 min and blocked with 50 mM Tris-HCl, 0.15 M NaCl, 90 μM CaCl₂, 4 μM EDTA, 0.01% NaN₃, and 2% bovine serum albumin at pH 8 for 1 h. The wells were then incubated for 1 h with a biotin hydrazide solution diluted 1/50 in NaAc, followed by europium (Eu)-labeled streptavidin diluted 1/1,000 in Delfia assay buffer (PerkinElmer, Waltham, MA, USA). Finally, plates were incubated with Delfia enhancement solution for 5 min on a shaker. Between steps, the plates were washed three times with a solution containing 5 mM Tris-HCl, 0.15 M NaCl, 0.005% Tween 20, and 0.01% NaN3, at pH 7.75, except for the final step, where plates were washed six times. The signal was measured in a Wallac 1420 Victor² microplate reader (PerkinElmer, Waltham, MA, USA) by time-resolved fluorometry.

MUC5AC and MUC2 ELISA.

Mucin fractions were diluted in 0.5 M GuHCl and coated overnight at 4°C onto 96-well plates (Nunc, Thermo Scientific). For MUC2 detection, samples were reduced with 80 μl of 2 mM DTT diluted in buffer (6 M GuHCl, 5 mM EDTA, 0.1 M Tris-HCl, pH 8.0) at 37°C for 1 h. On top of the previous solution, 20 μl of 5 mM IAA was added, and the mixture was incubated for 1 h in the dark. Plates were washed three times with PBS containing 0.05% Tween 20 (PBS-T) and blocked for 1 h with 1% blocking reagent for an enzyme-linked immunosorbent assay (ELISA) (Roche Diagnostics, Basel, Switzerland) in a mixture containing 0.05% Tween 20, followed by incubation with primary antibodies anti-MUC5CR and anti-MUC2C3 (both kindly provided by G. Hansson, University of Gothenburg, Gothenburg, Sweden) diluted 1/1,000. Three more washes with PBS-T were performed before and after wells were incubated with a horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA, USA) diluted 1/10,000 for 1 h. Subsequently, 100 μl of tetramethylbenzidine substrate (Sigma-Aldrich, St. Louis, MO, USA) was added per well, and the reaction was stopped with an equivalent volume of 0.5 M H₂SO₄. Absorbance at 450 nm was measured in a Wallac 1420 Victor² plate reader. The 45M1 antibody (Sigma-Aldrich, St. Louis, MO, USA) was used to confirm the specificity of the MUC5AC signal from the isolated mucins obtained with the anti-MUC5CR antibody, verifying the signal obtained with the soluble but not the insoluble mucins. As a result, we performed a range of control analyses with and without reduction and alkylation of the mucin samples, and we concluded that the absence of MUC5AC signal in the insoluble mucins in the experiments using the 45M1 antibody was due to the destruction of the epitope recognized by this antibody after reduction and alkylation. Thus, we are convinced that the MUC5AC signal is specific, although the antibodies were designed to detect human mucins.

Bacterial strain and culture conditions.

B. hyodysenteriae strain 8dII was cultured on tryptone soy agar (TSA; Thermo Fischer Scientific, Waltham, MA, USA) plates supplemented with 5% sheep blood (Thermo Fischer Scientific, Waltham, MA, USA), 0.1% yeast extract (Merck, Darmstadt, Germany), 400 μg/ml spectinomycin, 25 μg/ml colistin, and 25 μg/ml vancomycin (AppliChem, Darmstadt, Germany) at 40°C under anaerobic conditions.

Mucin sample preparation and concentration estimation.

Gradient fractions containing mucins were pooled to obtain one sample for each gradient (i.e., two [one insoluble and one soluble] from each pig). Mucin concentrations in pooled samples were determined by serial dilutions as well as by the use of a standard curve of a fusion protein of the mucin MUC1, consisting of 16TR and IgG2a Fc (25), starting at a concentration of 20 mg/ml and using seven 1:2 serial dilutions in a carbohydrate detection assay as described above. The mucin concentrations were calculated from the standard curve. Setting the concentration based on the glycan content appears most appropriate, as bacterium-mucin interactions largely occur via the mucin glycans (14). Although this is not an absolute measure of a concentration, it can be used to ensure that the mucins are at the same concentration for comparative assays. The concentration of mucin can also be determined by freeze-drying. However, not all of the mucins come into solution after freeze-drying; therefore, this method of concentration determination can result in large errors as well as in the selective removal of mucin species.

Binding of B. hyodysenteriae to pig mucins.

White 96-well plates (Corning Life Sciences, NY, USA) were coated overnight at 4°C with 6 μg/ml mucins in 0.5 M GuHCl. Wells were washed three times with PBS-T and blocked with 200 μl of 5% fetal bovine serum (FBS) for 1 h. Bacteria were harvested from TSA plates (as described above), washed in PBS, centrifuged at 2,500 × g for 5 min, and resuspended in PBS–5% FBS. A bacterial suspension (100 μl) diluted to10⁸ bacterial cells/ml was added per well, and the plates were shaken during incubation for 2 h at 40°C in an anaerobic environment. Plates were washed three times with PBS-T and once with PBS. Subsequently, 100 μl of PBS was added to each well, followed by the addition of an equal volume of BacTiter-Glo reagent (Promega, Madison, WI, USA). Incubation proceeded for 5 min at room temperature. Relative luminescence unit (RLU) was measured in an Infinite M200 microplate reader (Tecan, Männedorf, Switzerland) with an integration time of 1,000 ms per well. Controls included wells without the bacteria (PBS only) in mucin-coated wells and in non-mucin-coated wells incubated with the bacterial suspension followed by addition of PBS and reagent. In order to confirm that the differences in B. hyodysenteriae binding to pig mucins were not due to variations in the mucin glycan content between samples, plates for a glycan detection assay (described above) were simultaneously coated and the assay was performed with the binding experiments. Only samples with a glycan value of 17,000 to 24,000 Eu counts were included to ensure that the analysis occurred within the linear range of the assay, and the B. hyodysenteriae binding signal was normalized to the glycan value for that particular coating and mucin combination. Results were obtained from three independent experiments with five technical replicates for each mucin, and data were plotted as relative luminescence units per glycan unit.

Statistical analysis.

Statistical analysis was performed using GraphPad Prism version 6 software (La Jolla, CA, USA). Results are expressed as means ± standard errors of the means (SEM) for normally distributed data and as medians with interquartile ranges (IQR) for data that did not follow a normal distribution (determined using the D'Agostino-Pearson omnibus test). Data were analyzed using the Mann-Whitney test, the Kruskal-Wallis test, or one-way analysis of variance (ANOVA) wherever applicable, and P values of ≤0.05 were considered statistically significant.

RESULTS

Clinical signs, bacterial shedding, and histology after experimental inoculation.

Five inoculated pigs excreted B. hyodysenteriae in their feces and developed clinical signs of SD, including mucoid or hemorrhagic diarrhea. A milder case of diarrhea was observed in one of the five pigs with clinical signs of SD. The majority of the pigs had acute dysentery at the time of sacrifice (Table 1). Pig 4 had a longer duration of dysentery; however, the clinical signs did not change during the 25-day period, and the macroscopic lesions corresponded with those of acute dysentery. Pig 3 had recovered from clinical signs before the day it was euthanized. Fecal shedding of B. hyodysenteriae by the inoculated pigs that developed SD started simultaneously with the onset of clinical signs and continued until the time of sacrifice. The control pigs did not excrete B. hyodysenteriae in their feces and did not present any clinical signs of SD at any time point during the experiment. In line with previous reports (20, 26), severe lesions were observed in the colon of pigs with acute dysentery, including necrotic colitis, hyperemic mucosa, and fluid content with large amounts of mucus. Microscopically, the mucosa of pigs with SD had a thickened mucus layer (Fig. 1), the epithelium contained abundant goblet cells, and the colonic crypts were elongated, dilated, and filled with mucus and cell debris. Inflammatory cells were observed in the lamina propria, consisting of lymphocytes, plasma cells, and transmigrating neutrophils. The pigs in the control group, as well as the inoculated pigs that did not develop SD, had no significant histopathological lesions.

FIG 1.

Colon tissue sections from control and B. hyodysenteriae-inoculated pigs stained for MUC2 and MUC5AC. Immunofluorescence of MUC2 (green) and MUC5AC (red) in colon tissue counterstained with DAPI (blue) is shown. Panels A to C show the striated organization of the mucus in the colon of control pigs along with expression of MUC2. In contrast, panels D to F show a disorganized mucus barrier with de novo expression of MUC5AC and increased expression of MUC2 in the colon of pigs with clinical signs of SD.

Colonic mucus disorganization during swine dysentery is accompanied by de novo expression of MUC5AC and increased expression of MUC2.

Fluorescence microscopy of the pig colon tissue revealed that the mucus layer in the healthy pig colon, including in the colon of the inoculated pigs that did not develop SD, was organized in striations parallel to the mucosa and consisted mainly of the MUC2 mucin (Fig. 1A to C), similarly to the mucus structure reported for the mouse colon (2, 27). In contrast, during infection with B. hyodysenteriae, a massive increase in MUC2 levels and de novo production of MUC5AC was observed in the four inoculated pigs with severe clinical signs of dysentery (Fig. 1D to F). MUC5AC expression was not observed by immunofluorescence in the inoculated pig with milder clinical signs of dysentery. Both MUC2 and MUC5AC were produced by goblet cells, and when MUC5AC was present in a goblet cell, it was usually present in a cell that also produced MUC2 (Fig. 1D and E). In addition to the massive increase in mucus layer thickness that occurred in dysenteric pigs, the mucus organization was vastly changed by infection, as the striated organization was lost and the mucus appeared instead to flow in “rivers” with eukaryotic cells in between, often at a 45° angle from the mucosa.

The antibodies used have previously been shown to detect their specific targets in humans and mice (27, 28), but no MUC2 or MUC5AC antibodies have been verified for use in pigs. To be certain that the stain represented MUC5AC and MUC2, we confirmed that the antibodies we used for the immunofluorescence indeed bound to the isolated mucins in specific manners that differed between the antibodies (Fig. 2A and B). The specificity of the MUC5AC antibody was further supported by the use of a second antibody; both MUC5AC antibodies followed a tissue distribution in the porcine stomach analogous to the distribution observed in the human stomach and murine stomach. In addition, we designed qPCR primers specific for swine MUC2 and MUC5AC and, indeed, the mRNA levels of MUC2 and MUC5AC increased 4-fold and more than 15-fold, respectively, in the colon tissue of pigs with clinical signs of SD compared to the levels in the tissue from the control pigs (Fig. 3). The expression of MUC5AC was not upregulated in the colon tissue of the inoculated pig with milder clinical signs of dysentery. The mRNA levels of MUC1, a mucin gene whose expression is induced during some bacterial infections in the mouse (3, 11), did not increase in the pigs with SD compared to the controls (Fig. 3).

FIG 2.

MUC5AC and MUC2 content in the colon of B. hyodysenteriae-inoculated pigs. (A) The peak of antibody reactivity to MUC5AC and MUC2 coincided with the glycan detection peak in GuHCl-soluble mucin fractions isolated from a B. hyodysenteriae-inoculated pig with clinical signs of SD. (B) The mucin population of one pig was more heterogeneous with distinctly different mucin peaks, demonstrating that the antibodies against MUC2 and MUC5AC recognize different mucins. (C and D) MUC5AC (C) and MUC2 (D) antibody reactivity to GuHCl-soluble and insoluble mucins isolated from B. hyodysenteriae-inoculated pigs that developed SD (1, pig 1; 2, pig 2; 3, pig 3; 4, pig 4; 5, pig 5), inoculated pigs that did not develop SD, and control pigs. Results are expressed as the median with interquartile range. *, P < 0.05 (Kruskal-Wallis test with Dunn's correction for multiple comparisons).

FIG 3.

MUC5AC, MUC2, and MUC1 mRNA expression in B. hyodysenteriae-inoculated and control pigs. Data represent normalized fold expression levels of MUC5AC, MUC2, and MUC1 mRNA in the colon tissue of B. hyodysenteriae-inoculated pigs with clinical signs of SD and controls determined by qPCR analysis. Expression data were normalized to ACTB and RPL4 reference genes. Fold changes were calculated using the threshold cycle (ΔΔC_T) method. Results are expressed as medians with interquartile ranges. *, P < 0.05; **, P < 0.005 (Mann-Whitney test).

Swine dysentery is associated with a 5-fold increase in mucin content.

Mucins from B. hyodysenteriae-inoculated and control pigs were isolated from the colonic mucus and analyzed in order to determine changes in their composition during infection. Mucins were extracted as previously described (23), and GuHCl-soluble and insoluble mucins were obtained. Although the insoluble mucins were ultimately solubilized by reduction in DTT, they are referred to here as “insoluble.” During isopycnic density gradient centrifugation, molecules concentrate as bands where the molecule density matches the density of the surrounding solution. As mucins are highly glycosylated, and sugars have a high density, density gradient centrifugation separates mucins from the less glycosylated nonmucin molecules. The initial CsCl–4 M GuHCl isopycnic density gradient procedure rendered the isolated mucins free of nonmucin proteins; however, they were contaminated with DNA (Fig. 4A). Therefore, a second CsCl–0.5 M GuHCl gradient procedure was performed in all the samples, ensuring removal of DNA contamination (Fig. 4B). The median mucin density of the inoculated pigs was 1.527 g/ml (IQR = 0.015). No differences in mucin density between inoculated and control pigs were noted (P > 0.05) (Fig. 4D). Quantification of mucins based on their carbohydrate content revealed that the pig colon mucins of both B. hyodysenteriae-inoculated and control pigs were mainly insoluble, with less than 20% of the mucins being soluble in GuHCl (Fig. 4C). Pigs with clinical signs of SD had 5-fold-higher mucin content (P < 0.05) than the controls (Fig. 4C). The amount of mucins isolated from control pigs was similar to the mucin content of samples from the inoculated pigs that did not develop SD (P > 0.9) (Fig. 4C).

FIG 4.

Isolation, density, and glycan content of colonic mucins from B. hyodysenteriae-inoculated and control pigs. (A) Mucin fractions were recovered from the density gradients and analyzed for their glycan content. Here, a representative sample of soluble mucins isolated from a B. hyodysenteriae-inoculated pig with clinical signs of SD after the first gradient in CsCl–4 M GuHCl (starting density of 1.39 g/ml) shows that low-density nonmucin proteins (A₂₈₀) are excluded from the pooled mucin fractions. Bar, pooled mucin fractions 2 to 7. (B) Representative sample of soluble mucins isolated from a control pig, showing baseline separation between the glycan peak and DNA after a second gradient in CsCl–0.5 M GuHCl (starting density, 1.5 g/ml). Bar, pooled mucin fractions 1 and 2. (C) Glycan content of GuHCl-soluble and insoluble mucins isolated from inoculated pigs with clinical signs of SD (1, pig 1; 2, pig 2; 3, pig 3; 4, pig 4; 5, pig 5), inoculated pigs that did not develop SD, and control pigs. The mucin content in the colon was 5-fold higher in inoculated pigs with clinical signs of SD than in the controls. (D) Density (g/ml) of GuHCl-soluble and insoluble mucins isolated from control and B. hyodysenteriae-inoculated pigs (with and without clinical signs of SD), showing no differences between the groups. Results are expressed as medians with interquartile ranges. *, P < 0.05 (Kruskal-Wallis test with Dunn's correction for multiple comparisons).

In most density gradient samples, MUC5AC and MUC2 antibody reactivity coincided with the glycan peak (Fig. 2A), although there were differences in the MUC2 and MUC5AC curves in one sample, demonstrating that the antibodies indeed recognized different mucins (Fig. 2B). MUC5AC was present in the GuHCl-soluble material and the insoluble material in similar proportions (45% and 55%, respectively) (Fig. 2C). Mucins from the pigs with SD contained more MUC5AC than the mucins from the controls and the mucins from the inoculated pigs that did not develop SD (P < 0.05) (Fig. 2C). In line with the immunofluorescence and qPCR results, the pig with mild clinical signs of SD had the lowest level of MUC5AC antibody reactivity. Both GuHCl-soluble and insoluble mucins contained MUC2, with the majority (80% to 90%) of MUC2 present as insoluble mucin. In line with the immunofluorescence and qPCR results, the MUC2 protein level was also increased in pigs with SD compared to the controls and compared to the inoculated pigs that did not develop SD (P < 0.05) (Fig. 2D).

Increased ability of B. hyodysenteriae to bind to colonic mucins from pigs with clinical signs of swine dysentery.

B. hyodysenteriae bound to colonic mucins isolated from both control and inoculated pigs. The patterns of B. hyodysenteriae binding to mucins differed between individual pigs (insoluble mucins, overall P < 0.0001; soluble mucins, overall P < 0.0001) (Fig. 5A). This suggests that B. hyodysenteriae has an adhesin that recognizes a specific glycan structure(s), as bacterial adhesins usually recognize these, and that the mucin glycans differ between individuals (24). The level of B. hyodysenteriae binding per mucin glycan unit to soluble mucins from pigs with clinical signs of SD was higher than that seen with the controls (P < 0.0001), and a similar trend was observed for the insoluble mucins (P = 0.0595) (Fig. 5B). Although B. hyodysenteriae bound more to the soluble mucins isolated from pig 3 than to the soluble mucins isolated from other pigs with clinical signs of SD (Fig. 5A), the overall binding difference between control and inoculated pig mucins remained statistically significant (P = 0.0002) even after excluding the pig 3 data. Taking into account the fact that the total mucin content isolated from pigs with clinical signs of SD was higher than the mucin content isolated from healthy pigs, the ability of B. hyodysenteriae to bind to mucins from pigs with clinical signs of SD increased 7-fold (P < 0.005) (Fig. 5C).

FIG 5.

Binding of B. hyodysenteriae to colonic mucins. (A) Binding pattern of B. hyodysenteriae to soluble and insoluble mucins isolated from controls (pigs A to F) and inoculated pigs with clinical signs of SD (pigs 1 to 5). Results are expressed as the means ± SEM of the results of technical replicates. *, P < 0.05; ****, P < 0.0001 (one-way ANOVA, with Tukey's correction for multiple comparisons). (B) B. hyodysenteriae binding to soluble and insoluble mucins isolated from controls and pigs with SD, showing higher binding to the soluble mucins isolated from pigs with clinical signs of SD than to those isolated from the control group. Results are expressed as medians with interquartile ranges. ****, P < 0.0001 (Mann-Whitney test). (C) Binding ability of B. hyodysenteriae relative to the total mucin content observed in pigs with SD (1, pig 1; 2, pig 2; 3, pig 3; 4, pig 4; 5, pig 5) and control pigs (i.e., binding to mucin at a set concentration × the total amount of mucin recovered from that sample). Results are expressed as medians with interquartile ranges. **, P < 0.005 (Mann-Whitney test). Data shown are representative of the results of three independent experiments.

DISCUSSION

The present report provides new insights into the composition of pig colonic mucins during health and disease as well as into mucin interactions with B. hyodysenteriae. The insights resulted from validation, optimization, and generation of methods and tools that now can be specifically applied to the swine host. We demonstrated changes in the mucus environment of the swine colon during infection with B. hyodysenteriae, evidenced by disorganized mucus and a much thicker mucus layer as well as by 5-fold-higher mucin content, accompanied by de novo MUC5AC synthesis. We identified that B. hyodysenteriae bound to swine colonic mucins in manners that differed between individuals and mucin populations and that the levels increased with infection. As a result of these changes, the altered mucin environment provided more bacterial binding sites, increasing the overall binding ability of B. hyodysenteriae to colonic mucus 7-fold.

Successful isolation of mucins involves the removal of low-density nonmucin proteins as well as DNA contaminants. Pure colonic mucins, soluble and insoluble in GuHCl, were obtained by two isopycnic density gradient centrifugation steps in CsCl with different GuHCl molarities, as previously described (29). As in the case of human colonic mucus (30), we reported a higher content of insoluble mucins than of mucins soluble in guanidinium in the pig. Mucins are large molecules that form complex networks by connecting the mucin subunits via disulfide bonds. It has been suggested that the higher content of insoluble mucins in the colon denotes the presence of more covalent bonds, indicating the need for further solubilization by reduction (30). The density we observed for pig colonic mucins was higher than the density (1.38 g/ml) previously reported for human colonic mucins (30). Since human MUC2 and pig MUC2 are highly homologous and since human glycosylation is similar in monosaccharide composition to pig glycosylation, differences in density are likely to mainly reflect differences in the extent of glycosylation. Thus, pig colonic mucins appear to be more heavily glycosylated than the human counterparts. The main carbohydrates that compose glycoproteins both in humans and in pigs are glucosamine, galactosamine, galactose, fucose, and sialic acid (30–32).

Besides lubricating the intestinal surface for the transit of the fecal bolus, goblet cell-secreted mucus protects the surface epithelium from bacterial invasion. The mucus layer of healthy pigs was constituted mainly of MUC2 mucin, organized in a striated fashion perpendicular to the mucosal surface, similarly to the mucus composition of the mouse colon (6). During B. hyodysenteriae infection, we found a loss of the striated organization and a substantial increase in MUC2 and de novo secretion of MUC5AC mucins. We recently reported dynamic changes in the mucus barrier during Citrobacter rodentium infection in mice, with structural loss and decrease of the inner mucus layer at the onset and middle time points of infection (27). However, during the clearance phase, the mucus layer thickness increased but had an organization similar to that seen in uninfected mice, and no Muc5ac was detected (27). The changes observed in B. hyodysenteriae-infected pigs are thus completely different from any of the mucus changes identified during C. rodentium infection and clearance.

MUC2 and MUC5AC are both gel-forming mucins secreted by goblet cells. The MUC2 mucin is predominantly secreted in the intestine. There is evidence from Muc2 knockout mice that the lack of Muc2 increases the susceptibility to Salmonella and C. rodentium infections (33, 34). Unlike MUC2, MUC5AC does not form part of the normal mucin repertoire in the colon. Instead, it is commonly found in the normal gastric mucosa (5), airway epithelium (35), and conjunctiva (36). MUC2 and MUC5AC mRNA levels were increased in the colon tissue of pigs with clinical signs of swine dysentery compared to the levels in the control pigs, demonstrating that the mucus change is regulated at the transcriptional level, in contrast to the increases in mucus thickness seen in C. rodentium infection without changes in mRNA levels (27). Additionally, the fact that MUC1 expression was not increased in the inoculated pigs compared to the controls further supports the conclusion that B. hyodysenteriae infection has an effect on mucin regulation different from that seen in the C. rodentium model, where Muc1 levels are increased (27). Similarly to our results, expression of MUC5AC and MUC2 in rabbit ileal loops inoculated with Shigella flexneri and Shigella dysenteriae has been described (37). In addition, Muc5ac expression is increased in mice infected with the intestinal nematode Trichuris muris (38). In pigs, immunohistochemical staining with an antibody against human MUC5AC has indicated that the level of this mucin is increased during infection with Salmonella enterica serovar Typhimurium (39), while MUC5AC mRNA levels were elevated during infection with Trichuris suis (40). During nematode infection, Muc5ac induction has a protective role in mice, decreasing nematode burden and viability (41). Moreover, Muc5ac deficiency hampers the clearance of the parasite, increasing the susceptibility to chronic infection (41). Altered mucin expression in the colon of pigs with SD was first reported by Wilberts et al., after immunohistochemical staining with an antibody against human MUC5AC indicated its presence in pigs with acute dysentery following inoculation with B. hyodysenteriae or “B. hampsonii” (20), suggesting a common mucin response in the colon during infection with these pathogens. Our results suggest that during infection, de novo secretion of MUC5AC in the colon could depend on the stage of the disease, as it was not detected in the pig sacrificed 1 day after the onset of clinical signs, which presented with only mild diarrhea. Furthermore, the similar mucin profiles of the inoculated pigs that did not develop SD and the control pigs suggest that de novo secretion of MUC5AC in the colon depends on the ability of the bacterium to colonize the host. Further experiments are required to determine whether the de novo MUC5AC secretion plays a protective role during B. hyodysenteriae infection in the pig.

Successful colonization of the host by enteric pathogens involves penetration of the mucus layer overlying the epithelium. Genomic evidence shows that B. hyodysenteriae carries genes associated with potential virulence factors involved in motility, chemotaxis, and tissue injury by proteases and hemolysins that, if expressed, could facilitate colonization of the colon (42). Thus far, the importance of motility and chemotaxis in B. hyodysenteriae colonization has not been thoroughly demonstrated. A strong chemotactic response to pig mucins and components such as fucose and serine has been described (43, 44), although decreased attraction to mucins at concentrations greater than 6% has also been reported (45). Colonization of the gastrointestinal tract can also be mediated by bacterial adhesion to carbohydrate structures such as blood group antigens that act as receptors. For example, H. pylori strains that express the BabA adhesin bind to the Lewis b blood group antigen expressed in the human gastric mucosa, resulting in blood group- and strain-dependent binding (46), and the FedF adhesin expressed in F18-fimbriated E. coli binds to glycosphingolipids isolated from intestinal epithelium of blood group A and O pigs (47). AO blood group antigens are expressed in the pig intestine, with a predominance of blood group A (48); thus, individual pigs carry different glycan structures in their intestines. Here we showed that B. hyodysenteriae bound to mucins from all pigs in the study but that the levels of binding per mucin glycan unit differed between the mucin populations and with disease status. Given that other infections have been previously shown to induce changes in mucin glycosylation (49), it is likely that the differences in the levels of B. hyodysenteriae binding reflect differences in the pig-mucin glycan repertoire rather than differences in the mucin density or in the extent of glycosylation.

Mucins from pigs with clinical signs of SD bound more B. hyodysenteriae than mucins from the control pigs. During infection, the mucin secretion potentially provides distinct carbohydrate structures for B. hyodysenteriae binding. The mucous niche is very unstable, and pathogen binding to mucins may prevent the more intimate adherence that can occur between the pathogen and, for example, glycolipids of the cell membrane. Indeed, mucin binding to the human gastric pathogen H. pylori acts as a decoy and prevents prolonged adherence (13). Furthermore, in the rhesus monkey model of H. pylori infection, animals with mucins that bind H. pylori more effectively have a lower H. pylori density in their stomachs, indicating that mucin binding to H. pylori aids in removing the bacteria from the gastric niche (49). However, it is not certain if these principles apply to B. hyodysenteriae; the massively thick disorganized mucus layer may not be as unstable as a normal mucus layer, and there is a possibility that the protective function of the mucus changes under these conditions. B. hyodysenteriae may indeed induce these mucus changes to create a more favorable niche instead.

In conclusion, B. hyodysenteriae bound to mucins from all pigs in manners that differed between the mucin populations and increased with SD. Together with the massive mucus induction and disorganization that occurred during infection, this demonstrates the presence of major changes in the colon mucus niche during B. hyodysenteriae infection.