Table 2.
Primers used to determine the immediate genetic environment of dnd operons of E. coli strains
Primer | Oligonucleotide sequence (5' to 3') | Target gene | Amplicon size (bp) | Annealing temperature (°C) | Reference(s) |
---|---|---|---|---|---|
gp_a_US-F | AACAACTGTGGGTCAGCGAA | upstream of | 489 | 52 | this study |
gp_a_US-R | AGGCTATCTGATGCTCCCGA | dnd operon | |||
gp_b_US-F | TGGGGGTTGAGTCTGATGAT | upstream of | 723 | 52 | this study |
gp_b_US-R | TCGAATGGTGCTGAGTCGTC | dnd operon | |||
gp_cI_US-F | GAAACCAACCCTCTTTTCACGTC | upstream of | 823 | 52 | this study |
gp_cI_US-R | GTCTGATGCTCCCGAATCGAA | dnd operon | |||
gp_cII_US-F | ACCATCGAAAGCCCCATTAAGAG | upstream of | 760 | 52 | this study |
gp_cII_US-R | GCTGTCTGATGCTCCCGAAT | dnd operon | |||
gp_d_US-F | AGGCTGGAAGCCATGTTTTG | upstream of | 905 | 52 | this study |
gp_d_US-R | TTCGTCGATCAACTGCGTGA | dnd operon | |||
gp_e_US-F | CCATATGTCAGCTCAAGTCGC | upstream of | 612 | 52 | this study |
gp_e_US-R | TACTGATACGGAAGTGGATGAGC | dnd operon | |||
gp_f_US-F | GGGCGAGTTCGATGCTATGAC | upstream of | 595 | 53 | this study |
gp_f_US-R | TGGGGGAGACACTACAAGCTA | dnd operon | |||
gp_a_DS-F | ATTCGTGCCGGGAAACTCAT | downstream of | 636 | 52 | this study |
gp_a_DS-R | TCAGTGCTGTGCGTAGTGAG | dnd operon | |||
gp_b_DS-F | CGCTTTACGACGATGCTGAC | downstream of | 591 | 52 | this study |
gp_b_DS-R | GCGAAACCAAGACGTGG(A/T)CT | dnd operon | |||
gp_c_DS-F | CGTTGAGCGCGTAATTCTGG | downstream of | 582 | 52 | this study |
gp_c_DS-R | ATCAGGGGCTTCTTGCAGAC | dnd operon | |||
gp_d_DS-F | CGCGTCCATCGGTACACATA | downstream of | 558 | 52 | this study |
gp_d_DS-R | TGCCACTTCAGTGCTGACAA | dnd operon | |||
gp_e_DS-F | AACGGCAATAGACGCTGTCA | downstream of | 518 | 52 | this study |
gp_e_DS-R | AGCAACCGTCTTCGTTCTGT | dnd operon | |||
gp_f_DS-F | ACATCTGCTGGCTACGCTTT | downstream of | 715 | 52 | this study |
gp_f_DS-R | TTGTCATGCGGTCTTAGCGA | dnd operon |