Table 1.

List of primer used for Amplification and sequencing of dupA gene

Primer	Sequence (5′-3′)	PCR cycling condition	Amplicon size (bp)
SNT49F	ATGTTTCTTGGTTTAGAGGG	94°C 30 sec, 55°C 30 sec and 72°C 2.5 mins	2499
dupA2499R	TCACACATATTGAACATTCTCG	94°C 30 sec, 55°C 30 sec and 72°C 2.5 mins	2499
dupAF	ATGAGTTCTGTATTAACAGACTTTG	94°C 30 sec, 50°C 30 sec and 72°C 2 mins	1884
dupA2499R	TTAAATACTCTTCCTTATAAGTTTC	94°C 30 sec, 50°C 30 sec and 72°C 2 mins	1884
SNT49F	ATGTTTCTTGGTTTAGAGGG	94°C 30 sec, 55°C 30 sec and 72°C 1 mins	685
SNT49R685	CAGCGTATAAATTCAATAGATC	94°C 30 sec, 55°C 30 sec and 72°C 1 mins	685
dupAF	ATGAGTTCTGTATTAACAGACTTTG	94°C 30 sec, 50°C 30 sec and 72°C 1.5 mins	1172
dupA20R	CCTAAATTTTTGGCAATTTCTAATAAG	94°C 30 sec, 50°C 30 sec and 72°C 1.5 mins	1172
dupA16F	ACAATACTGCTAATACAGATG	94°C 30 sec, 55°C 30 sec and 72°C 1 min	947
dupA2499R	TCACACATATTGAACATTCTCG	94°C 30 sec, 55°C 30 sec and 72°C 1 min	947
SNT49_470F	ATGATTTTAAATTATGTAGAGACC	94°C 30 sec, 55°C 30 sec and 72°C 40 secs	623
SNT49R350	GCATTAACAATTTTTTTAGCG	94°C 30 sec, 55°C 30 sec and 72°C 40 secs	623
918 F	CCTATATCGCTAACGCGCTC	94°C 30 sec, 55°C 30 sec and 72°C 40 secs	791
jhp0919R	CTTTTTGTGATTTCATGAAACTC	94°C 30 sec, 55°C 30 sec and 72°C 40 secs	791