Table 1. The multiplex real-time PCR primers and TaqMan probes for detection of Clostridium difficile, its specific toxins A and B, and binary toxin A genes.
| Main target | Target genes | Sequence | GenBank accession number |
|---|---|---|---|
| C. difficile | tpi | F: 5'-gaagctactaagggtacaaa-3' | FN668944 |
| R: 5'-ggtctattcctacttctaatgc-3' | FN668941 | ||
| Probe: 5'-VIC ataagaggtgaaacttctcctgtaaatgctcc TAMRA-3' | FN668375 | ||
| FN665654 | |||
| FN665653 | |||
| Toxin A | tcdA | F: 5'-tgataacgtatagcttgacc-3' | DQ117264 |
| R: 5'-atggtttacctcagatagg-3' | DQ117255 | ||
| Probe: 5'-FAM tgaatactttgcacctgctaatacggatg TAMRA-3' | DQ117249 | ||
| DQ117248 | |||
| DQ117247 | |||
| Toxin B | tcdB | F: 5'-gaaggattacctgtaattgc-3' | HM062511 |
| R: 5'-ctgccattatacctatcttagc-3 | HM062510 | ||
| Probe: 5'-VIC ctctttgattgctgcacctaaacttacacc TAMRA-3' | HM062509 | ||
| HM062508 | |||
| HM062507 | |||
| Binary toxin A | cdtA | F: 5'-tatattaaagcagaagcatctgt-3' | DQ102377 |
| R: 5'-ctggaccatttgatattaaataatt-3' | DQ102378 | ||
| Probe: 5'-FAM tcctccacgcatataatcatttacatcagc TAMRA-3' | DQ102375 | ||
| DQ102376 | |||
| AJ238325 |
Abbreviations: tpi, Clostridium difficile specific triose phosphate isomerase gene; tcdA, toxin A gene; tcdB, toxin B gene; cdtA, binary toxin gene.