Table 1.
Sequences of oligonucleotides used in this study.
| Name | Sequence (5'→3') |
|---|---|
| I7 for | gctagcatggagcgaaggaaccacag |
| I7 His rev | ggtaccctaaccaattttgctgcctttgt |
| Linker 1 | catgggggctagcgattgcgatccgattcggtac |
| Linker 2 | cgaatcggatcgcaatcgctagccc |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.