What is known on angiogenesis-related rare diseases? A systematic review of literature

Abstract

Angiogenesis, the formation of new vessels from pre-existing ones, is essential during ontogenetic development and is related to many important physio-pathological processes in the adult. In fact, a persistent and deregulated angiogenesis is a required event for many diseases and pathological situations, including cancer progression and metastasis. Some rare diseases are also angiogenesis-related pathologies. However, there is a lack of an exhaustive review on the topic. The main purpose of this work is to carry out a systematic review of literature to determine what (and how much) scientific information concerning angiogenesis-related rare diseases can be extracted from available sources. After exhaustive searches in bibliographic databases, preselected data were filtered by selecting only those articles on rare diseases with an Orpha number hosted in the Orphanet web. The selected bibliographic references were further curated manually. With the 187 selected references, a critical reading and analysis was carried out allowing for an identification and classification of angiogenesis-related rare diseases, the involved genes and the drugs available for their treatment, all on the basis of the information available in Orphanet database.

Introduction

A disease is considered rare when its low incidence becomes a problem to be added, making more difficult its accurate diagnosis and decreasing the interest in its research and the development of drugs for its treatment. According to the definition provided by the European Union, rare diseases are those with prevalence values lesser than 5/10,000 and leading patients to higher risk of death or chronic disability. Although it is difficult to estimate the exact number of rare diseases, most probably this number is within the range 6000–8000. More than 2000 rare diseases have already one or more genes assigned; see (http://www.rdplatform.org) and 1. The greatest database on the subject, Orphanet (http://www.orpha.net/consor/cgi-bin/index.php) contains information on almost 6000 rare diseases. Therefore, although each rare disease is infrequent, altogether rare diseases affect to 6–8% of total population in developed countries. Currently, more than 30 millions of European citizens suffer from some kind of rare disease and are exposed to discriminatory medical care benefits. Different projects have been financed under the Programme for Community Action on Rare Diseases in 1999–2003; the EU Public Health Programme 2003–2007 and the second EU Health Programme 2008–2013 (http://ec.europa.eu/health/rare_diseases/projects/cooperation/index_en.htm).

A fundamental question arises: how to get access to this highly specialized and very reduced knowledge area where each described rare disease becomes an isolated particularity? A reasonable option could be the comparative study of analogies among different rare diseases (http://www.orpha.net/consor/cgi-bin/Education_Home.php?lng=EN). However, the low prevalence (the fact of being rare) is the only descriptor that—by definition—can be applied in any methodology for the systemic study of all or a group of rare diseases. This description based on low prevalence is crucial for the integration of medical policies in the framework of rare diseases, but on the other hand it contributes nothing to the molecular description of rare diseases and the physio-pathological relationships they could share. This is the current situation, in spite of the fact that next-generation sequencing technologies and exome analysis are making possible to identify molecular markers for some rare diseases 2.

The specification of classification systems able to order the collected information on a disease according to coherent categories and criteria plays an essential role in biomedical sciences. In particular, this is of paramount importance for the description and diagnosis of rare diseases and for the adoption of decisions concerning health care, clinical and therapeutical indications and derivation of patients to specialists. In this context, Orphanet and WHO (World Health Organization) are currently making important efforts for the future specification of the international classification of diseases ICD11 (http://www.who.int/classifications/icd/revisionnews/en/), which will include rare diseases for the first time 3. Unfortunately, there is still a lack of a clinical identification accredited for this kind of diseases. In consequence, the search for information on rare diseases remains complex and diffuse.

Specific problems also arise from the usual way in which the scientific literature is written. Unfortunately, scientific literature does not use to identify rare diseases as such and the identifiers for them proposed (i.e. ORPHA or OMIM IDs) are scarcely mentioned. In consequence, the search of information on rare diseases through the primary sources of scientific documentation is not an easy task. In fact, the finding of common relationships among diseases depends mainly on the reduced and specialized area of knowledge that dominates each rare disease, a fact that severely limits the visibility of these relationships.

Far beyond the epidemiological, clinical and molecular studies and decision making in public health, the adoption of wider and more general and holistic approaches could become a new way to access to new knowledge in this area. The implementation of informatics resources to extract data from scientific literature and to analyze and enrich this information is currently contributing to the advancement of knowledge in biomedicine. This could be a powerful strategy to establish emerging sources of knowledge also in the specific field of rare diseases.

A systematic review and collection of relevant information contained in diverse sources of scientific information and documentation could provide new valuable, emergent information concerning rare diseases. In the present work, we apply this systemic approach to get a deeper insight on the current knowledge of angiogenesis-related rare diseases (A-RDs).

Angiogenesis, the formation of new vessels from the pre-existing vasculature, is one main mechanism of vascularisation during normal and specific physiological processes, such as embryonic development, growth, regeneration, wound healing and formation of corpus luteum and endometrium. Angiogenesis attracted wide interest in the scientific community when the pioneering hypothesis of Judah Folkman in 1971 that tumor progression and metastasis are dependent on angiogenesis (and, as such, cancer could be therapeutically attacked by inhibiting angiogenesis) began to be confirmed by experimental studies since the eighties 4–6. In fact, inhibition of this process has become a major challenge in the development of new anticancer agents, with more than 40,000 scientific papers published on this subject, and about a hundred anti-angiogenic compounds entered in clinical trials, and numerous others in preclinical development 7–9. Currently, it is well established that a deregulated and persistent angiogenesis is one of the hallmarks of cancer 10,11. Furthermore, there is overwhelming evidence on the involvement of deregulated angiogenesis in many other pathological situations, which are currently described as angiogenesis-dependent diseases 12. The interest and impact of angiogenesis as a new therapeutical target from the treatment of non-oncological angiogenesis-dependent diseases is well represented by the recent concession of the Lasker-Debakey Clinical Medical Research Award 2010 to Dr. Napoleone Ferrara for the discovery of VEGF as a major mediator of angiogenesis and the development of an effective anti-VEGF therapy for wet macular degeneration, a leading cause of blindness in the elderly 13. This is a type of age-related macular degeneration, included as a rare disease in the Orphanet website with the Orpha number ORPHA279. Other two examples of A-RDs are POEMS syndrome (ORPHA2905) 14,15 and Amyotrophic lateral sclerosis (ORPHA803) 16.

In fact, a number of the so far described rare diseases are infrequent types of neoplasia, most probably related to angiogenesis. Furthermore, many other rare diseases could be related to angiogenesis. However, there is a lack of an exhaustive and systematic review on the topic “angiogenesis related rare diseases”. To contribute to fill this gap is the main aim of the present review. To reach this goal, our group can make use or our previous experience in the management of databases and the implementation of bioinformatics tools 17–19. As a research group integrated in the Spanish Network of Rare Disease Research (http://www.ciberer.es/index.php?lang=english), we are actively involved in the search of new sources of knowledge in this research area. In the present work, we aim to evaluate how much and what kind of information we are able to uncover in the context of A-RDs. Furthermore, we also evaluate what kind of information contained in Orphanet can be extracted within the frame of our systematic search.

Methods

State of the art

The aim of this study was to perform a systematic study on the following question: what scientific information can be drawn from those rare diseases that are related to the topic called angiogenesis? To this end, we adapted the methodology stated in PRISMA statement (http://www.prisma-statement.org/statement.htm) for the systematic review of the whole set of documents that could be extracted from the databases used in this study 20,21. Table S1 in Supplementary material is the completed PRISMA checklist.

Strategy for the literature search

Eligibility criteria

Types of studies: This is a bibliometric study for the capture and identification of rare diseases appearing in different sources of scientific documentation and that are somehow related to angiogenesis.

Report eligibility: The scientific information specified in the previous section was exhaustively collected from scientific publications, namely, reviews, articles, case reports, proceedings and patents. The publication time ranged from 1991 to 2010 and there was no restriction concerning language or kind of publication. This search was dated in June of 2010 and updated in December of 2010. The whole set of collected rare diseases related to angiogenesis was submitted to a filter and selection procedure, according to their presence or not within a specialized database for rare diseases (Orphanet).

Information sources

For the selection of scientific publications concerning rare diseases somehow related to angiogenesis, an online search of literature was carried out in both PubMed and ISI Web of Knowledge databases.

Search terms used were “rare disease” as a generic term and “angiogen*”. The use of the two terms “rare” and “disease” juxtaposed allowed to include any pathology with its name before the search term “disease” (i.e. Castleman disease, Von Willebrand disease, Wilson disease, Menkes disease, Crohn disease, among others) and made possible to associate the search term “rare” with other related semantic terms, such as in the cases of rare tumor, rare pathology or rare disorder, among others. Finally, the term “angiogen*” was used as a root belonging to the generic term of angiogenesis and/or all possible variants.

As mentioned above, to validate the rare diseases found in this initial literature search, Orphanet database was used. Only those rare diseases contained and indexed within this database were confirmed and used for the rest of the study.

Search

In PubMed database, search terms were introduced in Advanced search without time limit or any other limit and listed as “(rare disease) AND angiogen*”, according to the following structured search: “rare diseases”[MeSH Terms] OR (“rare”[All Fields] AND “diseases”[All Fields]) OR “rare diseases”[All Fields] OR (“rare”[All Fields] AND “disease”[All Fields]) OR “rare disease”[All Fields], along with more specific terms that appear by default in Medical Subject Heading (MeSH) hierarchical structure in Medline. MeSH categories were: Orphan Drug Production / All MeSH Categories / Diseases Category / Pathological Conditions, Signs and Symptoms / Pathologic Processes / Disease Attributes / Rare Diseases. The MeSH terms were: Disease, Rare / Diseases, Rare / Rare Disease / Orphan Diseases / Disease, Orphan / Diseases, Orphan / Orphan Disease.

Search terms were introduced in ISI Web of Knowledge database as topics in both cases. The annotated search structure was as follows: Topic=(rare disease) AND Topic=(angiogen*). Timespan=All Years.

Study selection

Bibliography selection

The two lists of publications mentioning one or several rare diseases somehow related to angiogenesis obtained by searching PubMed and ISI Web of Knowledge as described above were merged into a unique list containing all the entrances without repetition. In order to reduce the bias among the selected data and the data that really fit the list of search terms, all the information extracted was reviewed and verified. To reach this goal, all the publications contained in the merged list were revised one by one by making a strategic reading of them 22. An analysis of matches was performed looking for the occurrence of the following terms “rare disease”, and/or “rare”, and/or “disease” and “angiogenic *” or “VEGF” in all titles, abstracts, author keywords and keywords plus found and MeSH terms. All the references that did not support this exclusion analysis were removed.

Rare diseases selection

Only those references containing explicit reference to one or more rare diseases (and therefore listed in Orphanet database with an Orpha identification number) were used to select those rare diseases included in the set to be further analyzed.

Data collection process and synthesis of indexed information

Data bibliographic systematic review

Once all the bibliographic information related to rare disease and angiogenesis was confirmed and validated, we proceeded to the analysis and compilation of all data of interest that Orphanet website could bring to the state of the art. All the collected data were allocated in sheets for the management of data in Excel format. This election was based on: (i) the easy access and operability of this format, (ii) the easy identification of data through the search option, and (iii) the capability to recover the original source of information through online links.

In a first column, the titles of all the selected bibliographic references in the study were included. The order or entrance was assigned according to publication dates, from the most recent to the oldest one.

All found and selected bibliographic references were categorized for each Orpha identification number validated with the applied selection criteria.

Initial classification of angiogenesis-related rare diseases

A first general classification criterion was established according to which each disease was assigned to one of the three following disjoined subsets: A (A-RDs with cancerous phenotype in all their features), B (A-RDs with cancerous phenotype only in some of their features) and C (A-RDs without cancerous phenotype). To determine the three subsets, a systematic search of the semantic terms “tumor” and “cancer” and the sufix “-ome” was carried out within the classification that orpahanet exposes for rare diseases. The terms glaucome, angiokeratome, lysosome, pseudoxanthome and hamartome were excluded due to obvious reasons. After this, all corresponding genes and orphan drugs were seized from Orphanet database, categorized for each Orpha identification number and associated to A-RDs in different sheets.

Bioinformatics analysis of bibliographic systematic review

To validate our manual systematic review of literature, we carried out an additional bioinformatics text mining study. The list of PubMed IDs (PMIDs) was obtained from the initial systematic review (all references of supplementary material, with the exception of references 5, 41, 44, 63 and 71) and uploaded into the text mining web application SciMiner 23. A biomedical literature mining analysis and the subsequent enrichment analysis were carried out concerning to those Medical Subject Headings (MeSH) associated with the retrieved PMIDs from the systematic review.

Results of the literature search and orphanet analysis

Bibliographic systematic review

As shown in the scheme depicted in Figure1, the search in ISI Web of Knowledge yielded 284 references, whereas that carried out in PubMed yielded 263 references. From all these references, only 187 fulfilled the selection criteria for their inclusion in the set to be further analyzed. The complete set of the 187 selected bibliographic references conforms the bibliography included in the Supplementary material and they validate the entrance of 180 A-RDs indexed in the database Orphanet (see Methods). An evaluation of this bibliographic set using PMIDs was carried out as described (see Methods). To avoid the occurrence of trivial MeSH terms, we have considered statistically significant only those terms with a P-value lower than 1.0E-5 and an enrichment (t-ratio/b-ratio) greater than 40. The results are shown in Table1. Figure S1 (Supplementary material) shows the PRISMA flow diagram corresponding to this systematic review.

Fig 1.

Flow of information through the different phases of bibliographic systematic review.

Table 1.

Bioinformatic analysis of bibliographic systematic review

MeSH	t+	t−	b+	b−	WholeSize	t-Ratio	b-Ratio	t-ratio/b-ratio	P-value
Angiogenesis inhibitors	33	149	8120	19,435,023	19,443,143	0.18	4.18E-04	434.2	6.18E-76
Neovascularization, pathologic	31	151	22,709	19,420,434	19,443,143	0.17	1.17E-03	145.8	9.89E-57
Vascular endothelial growth factor A	18	164	20,847	19,422,296	19,443,143	0.1	1.07E-03	92.2	9.41E-30
Thalidomide	12	170	4628	19,438,515	19,443,143	0.07	2.38E-04	277	6.17E-26
Herpesvirus 8, human	9	173	3009	19,440,134	19,443,143	0.05	1.55E-04	319.5	2.49E-20
Macular degeneration	7	175	7925	19,435,218	19,443,143	0.04	4.08E-04	94.4	2.06E-12
von Hippel–Lindau disease	5	177	1744	19,441,399	19,443,143	0.03	8.97E-05	306.3	9.10E-12
Lymphangioleiomyomatosis	4	178	569	19,442,574	19,443,143	0.02	2.93E-05	751	3.29E-11
Endothelial cells	7	175	15,420	19,427,723	19,443,143	0.04	7.93E-04	48.5	2.05E-10
Carcinoma, renal cell	7	175	16,035	19,427,108	19,443,143	0.04	8.25E-04	46.6	2.68E-10
Exudates and transudates	6	176	8354	19,434,789	19,443,143	0.03	4.30E-04	76.7	2.75E-10
Hypoxia-inducible factor 1, alpha subunit	5	177	4123	19,439,020	19,443,143	0.03	2.12E-04	129.6	6.57E-10
Vascular malformations	3	179	311	19,442,832	19,443,143	0.02	1.60E-05	1030.5	4.11E-09
Telangiectasia, hereditary hemorrhagic	4	178	1929	19,441,214	19,443,143	0.02	9.92E-05	221.5	4.25E-09
Activin receptors, type II	3	179	346	19,442,797	19,443,143	0.02	1.78E-05	926.3	5.65E-09
Hemangioendothelioma, epithelioid	3	179	459	19,442,684	19,443,143	0.02	2.36E-05	698.2	1.31E-08
Vascular endothelial growth factors	5	177	7692	19,435,451	19,443,143	0.03	3.96E-04	69.4	1.44E-08
Angiogenic proteins	3	179	482	19,442,661	19,443,143	0.02	2.48E-05	664.9	1.52E-08
POEMS syndrome	3	179	486	19,442,657	19,443,143	0.02	2.50E-05	659.4	1.56E-08
Osteolysis, essential	3	179	541	19,442,602	19,443,143	0.02	2.78E-05	592.4	2.15E-08
Hemangioma, capillary	3	179	665	19,442,478	19,443,143	0.02	3.42E-05	481.9	3.97E-08
Protein kinase inhibitors	5	177	10,840	19,432,303	19,443,143	0.03	5.58E-04	49.3	7.82E-08
Interferon-alpha	5	177	11637	19,431,506	19,443,143	0.03	5.99E-04	45.9	1.11E-07
Pyrroles	5	177	11,893	19,431,250	19,443,143	0.03	6.12E-04	44.9	1.23E-07
Von Hippel–Lindau tumor suppressor protein	3	179	1082	19,442,061	19,443,143	0.02	5.56E-05	296.2	1.70E-07
Hypoxia-inducible factor 1	3	179	1746	19,441,397	19,443,143	0.02	8.98E-05	183.6	7.10E-07
Endothelial growth factors	4	178	7866	19,435,277	19,443,143	0.02	4.05E-04	54.3	1.12E-06
Sarcoma, kaposi	4	178	8163	19,434,980	19,443,143	0.02	4.20E-04	52.3	1.30E-06
Linkage disequilibrium	4	178	8690	19,434,453	19,443,143	0.02	4.47E-04	49.2	1.66E-06
Rare diseases	3	179	2370	19,440,773	19,443,143	0.02	1.22E-04	135.2	1.77E-06
Collagen type XVIII	2	180	202	19,442,941	19,443,143	0.01	1.04E-05	1057.7	1.80E-06
Receptors, vascular endothelial growth factor	3	179	2497	19,440,646	19,443,143	0.02	1.28E-04	128.4	2.06E-06
Lipoid proteinosis of urbach and wiethe	2	180	246	19,442,897	19,443,143	0.01	1.27E-05	868.5	2.67E-06
Retinal vessels	4	178	9999	19,433,144	19,443,143	0.02	5.14E-04	42.7	2.88E-06
Stem cell transplantation	4	178	10,093	19,433,050	19,443,143	0.02	5.19E-04	42.3	2.99E-06
Receptors, CXCR4	3	179	3315	19,439,828	19,443,143	0.02	1.70E-04	96.7	4.80E-06
Dacarbazine	3	179	3542	19,439,601	19,443,143	0.02	1.82E-04	90.5	5.84E-06

MeSH, medical subject headings; t+, number of papers annotated with the MeSH in the sample PMIDs; t−, number of papers not annotated with the MeSH in the sample PMIDs; b+, number of papers annotated with the MeSH in whole PMIDs; b−, number of papers not annotated with the MeSH in whole PMIDs; WholeSize, whole PMIDs; t-ratio, proportion in the sample PMIDs; b-ratio, proportion in the whole PMIDs; t-ratio/b-ratio, value relative to the enrichment of the MeSH term; and P-value, Hypergeometric test value.

Initial classification of angiogenesis-related rare diseases

When this analysis was carried out, the Orphanet web contained 5781 rare diseases. This means that a 3% of all the described rare diseases can be considered as A-RDs.

In the present work, the distribution of A-RDs within the subsets A, B, C as a function of the classification range pointed by Orphanet (for those which have a classification in this database) was analyzed. This initial classification was based on the tight physio-pathological relationship of cancer with angiogenesis 4–9, their relevant clinical and pharmacological applications 7–9 and the bibliographic relevance of the Boolean descriptor “cancer AND angiogenesis”. As expected, the greatest subset is that of rare oncologic diseases (subset A), which amounted up to 81 A-RDs. However, the subset C (A-RDs without cancerous phenotype) was almost as big, containing 76 non-oncologic A-RDs. Finally, the subset B (A-RDs with cancerous phenotype only in some of their features) contained 23 diseases, most of them increasing the risk of developing a cancer. Table2 show the lists of A-RDs in each of the three subsets, their relationship with bibliographic references of the supplementary material and the number of genes and drugs associated to each A-RD.

Table 2.

Angiogenesis-related rare diseases

n°	References	Orpha ID	Rare disease	Orpha genes	Orpha drugs
Subset A (rare oncologic diseases)
1	[1, 136]	519	Acute myeloid leukemia (ARD)*	19	33
2	[59]	213772	Adenocarcinoma of the cervix uteri	0	0
3	[128]	1501	Adrenocortical carcinoma	0	1
4	[47]	163699	Alveolar soft-part sarcoma	2	0
5	[114]	142	Anaplastic thyroid carcinoma	0	1
6	[52]	86886	Angioimmunoblastic T-cell lymphoma	0	0
7	11	98731	Arteriovenous fistula	0	0
8	[23, 26, 68, 79, 105, 143]	211266	Arteriovenous malformation	0	0
9	[51]	157980	Bladder Cancer	0	0
10	[125, 134]	223727	Bone sarcoma	7	0
11	[83]	3395	Brain tumor (ARD)*	17	0
12	[165]	97287	Bronchial endocrine tumor	0	0
13	[26]	137667	Capillary malformation-arteriovenous malformation	1	0
14	[45, 112, 143, 152]	164	Cerebral cavernous malformations	0	0
15	[99]	86829	Chronic neutrophilic leukemia	0	0
16	[61]	99970	Dedifferentiated liposarcoma	0	0
17	[61]	31112	Dermatofibrosarcoma protuberans	2	0
18	15	141209	Diffuse lymphatic malformation	0	0
19	[29, 138, 167]	877	Endocrine tumor	2	2
20	[29]	100092	Enteropancreatic endocrine tumor	0	2
21	[103]	99871	Eosinophilic granuloma	0	0
22	[65, 98, 139, 162]	157791	Epithelioid hemangioendothelioma	0	0
23	[147, 149]	99976	Esophageal adenocarcinoma	0	0
24	[149]	99977	Esophageal squamous cell carcinoma	1	0
25	[61, 134]	319	Ewing sarcoma	5	0
26	[51, 146, 164]	733	Familial adenomatous polyposis	1	4
27	[64]	523	Familial leiomyomatosis	1	0
28	20	99361	Familial medullary thyroid carcinoma	0	0
29	[39, 42, 47, 92, 104, 159, 160]	151	Familial renal cell carcinoma (ARD)*	11	22
30	[70, 135]	63443	Gastric cancer	2	5
31	[61, 97]	44890	Gastrointestinal stromal tumor	2	5
32	[5, 36, 83]	360	Glioblastoma	8	33
33	[5, 83]	182067	Glial tumor (ARD)*	9	26
34	[45]	83454	Glomuvenous malformation	1	1
35	[34]	99915	Granulosa cell malignant tumor	0	0
36	[184]	58017	Hairy cell leukemia	0	2
37	[76]	2126	Hemangiopericytoma	0	0
38	[123, 137]	88673	Hepatocellular carcinoma (ARD)*	2	14
39	[141]	227535	Hereditary breast cancer	0	0
40	[94, 107]	29072	Hereditary pheochromocytoma-paraganglioma syndrome	6	0
41	[166, 167]	97279	Insulinoma	0	3
42	[87, 118, 144, 158, 162, 169, 172, 177, 179, 180, 181, 185, 186]	33276	Kaposi's sarcoma	0	5
43	22	213807	Leiomyosarcoma of the cervix uteri	0	0
44	22	213625	Leiomyosarcoma of the corpus uteri	0	0
45	[111]	65285	Lhermitte-Duclos disease (ARD)*	1	0
46	[141]	524	Li-Fraumeni syndrome	2	1
47	[173]	69078	Liposarcoma	1	2
48	[24, 75]	168811	Malignant peritoneal mesothelioma	0	0
49	[67, 112]	3148	Malignant Schwannoma	0	0
50	6	98292	Mastocytosis	1	1
51	[20, 165]	1332	Medullary thyroid carcinoma	1	3
52	[56]	97338	Melanoma of soft part	2	0
53	[24, 75]	50251	Mesothelioma	0	3
54	[55, 77, 140, 166, 178, 184]	29073	Multiple myeloma	2	23
55	1	52688	Myelodysplastic syndromes	2	10
56	[61]	99967	Myxoid liposarcoma	1	0
57	[80]	209989	Non-papillary transitional cell carcinoma of the bladder	0	1
58	[134]	668	Osteosarcoma	2	5
59	[59]	213504	Ovarian adenocarcinoma	0	7
60	[142]	2800	Paget disease extramammary	0	0
61	[165]	217074	Pancreatic carcinoma	7	21
62	[94]	717	Pheochromocytoma and secreting paraganglioma (ARD)*	8	1
63	[14, 66, 115]	2905	POEMS syndrome	0	0
64	[87, 169, 172, 177, 180]	48686	Primary effusion lymphoma	0	0
65	[87, 144, 169, 172, 180, 181]	99923	Primary effusion lymphoma associated with HIV infection	0	0
66	[59]	213528	Rare adenocarcinoma of the breast	0	0
67	[74]	180250	Rare breast cancer (ARD)*	12	0
68	[12, 28, 39, 42, 47, 57, 63, 84, 92, 104, 122, 159, 160, 182]	217071	Renal cell carcinoma (ARD)*	12	24
69	[61]	69077	Rhabdoid tumor	2	0
70	[165]	70573	Small cell lung cancer	0	4
71	[9, 22, 56, 97, 125, 173]	3394	Soft tissue sarcomas	20	10
72	[162]	210584	Spindle cell hemangioma	0	0
73	[93]	67037	Squamous cell carcinoma of head and neck (ARD)*	4	5
74	[131]	99868	Thymic carcinoma	0	0
75	[131]	3398	Thymic epithelial tumor	0	0
76	[131]	100100	Thymic tumor	0	0
77	[131]	99867	Thymoma	0	0
78	[133]	1063	Tufted angioma	0	0
79	[52]	86885	Unspecified peripheral T-cell lymphoma	0	4
80	[85, 88, 159]	39044	Uveal melanoma	0	1
81	[61]	99971	Well-differentiated liposarcoma	0	0
Subset B (A-RDs with cancerous phenotype only in some of their features)
1	[111]	109	Bannayan-Riley-Ruvalcaba syndrome (ARD)*	1	0
2	[89, 184]	521	Chronic myeloid leukemia (ARD)*	3	12
3	[69]	53721	Cobb syndrome	0	0
4	[60, 109]	191	Cockayne syndrome	5	0
5	[95]	2414	Congenital pulmonary lymphangiectasia	0	0
6	[111]	201	Cowden syndrome (ARD)*	3	0
7	17	324	Fabry disease	1	3
8	[15,16, 73, 118]	73	Gorham-Stout disease	0	0
9	[35, 110]	90308	Klippel-Trenaunay syndrome (ARD)*	1	0
10	[90]	389	Langerhans cell histiocytosis	0	1
11	[174]	79383	Lymphedema (ARD)*	4	0
12	[50]	2451	Mucocutaneous venous malformations (ARD)*	1	1
13	[166, 167]	652	Multiple endocrine neoplasia type 1	2	2
14	[89, 148]	824	Myelofibrosis with myeloid metaplasia	1	2
15	[2, 61]	636	Neurofibromatosis type 1 (ARD)*	3	2
16	[53]	2869	Peutz-Jeghers syndrome	1	0
17	[91]	42775	PHACE syndrome	0	0
18	[89]	729	Polycythemia vera	1	5
19	[174]	77240	Primary lymphedema	2	0
20	[8,13,23, 45, 79, 105, 143]	774	Rendu-Osler-Weber disease (ARD)*	3	1
21	[37, 88]	3205	Sturge-Weber syndrome	0	0
22	[12, 29, 39, 42, 84, 88, 92, 122, 130, 161, 170, 182]	892	Von Hippel–Lindau disease (ARD)*	1	2
23	[187]	913	Zollinger-Ellison syndrome	1	3
Subset C (A-RDs without cancerous phenotype)
1	[25]	93585	Acquired thrombotic thrombocytopenic purpura due to anti-ADAMTS 13 antibodies	0	1
2	[54]	79126	Acute interstitial pneumonia	0	0
3	[19, 27, 32, 40, 43, 48, 62, 88, 176]	279	Age-related macular degeneration	6	1
4	[58, 126]	803	Amyotrophic lateral sclerosis (ARD)*	17	10
5	[35, 110]	2346	Angio-osteohypertrophic syndrome (ARD)*	2	0
6	[25]	2134	Atypical hemolytic uremic syndrome (ARD)*	6	3
7	[154]	3453	Autoimmune polyendocrinopathy type 1	1	0
8	[46]	117	Behcet disease	0	2
9	21	131	Budd-Chiari syndrome	0	0
10	[30, 120]	36258	Buerger's disease	0	0
11	[152]	136	CADASIL syndrome	1	0
12	[31, 179, 185]	160	Castleman disease	0	2
13	[154]	178029	Central diabetes insipidus	1	0
14	[68]	98044	Central nervous system malformation	0	0
15	[40]	179	Chorioretinopathy, Birdshot type	1	0
16	[155]	2137	Chronic autoimmune hepatitis	0	1
17	[117]	183	Churg-Strauss syndrome	0	1
18	[40, 109]	190	Coats disease	1	0
19	[78]	2041	Coronary arterial fistulas	0	0
20	[6, 103, 133]	206	Crohn disease	5	0
21	[116]	137698	Cytomegalovirus disease in patients with impaired cell mediated immunity deemed at risk	0	1
22	[68]	97339	Dural sinus malformation	0	0
23	[40]	40923	Eales disease	0	0
24	[165]	99889	Ectopic Cushing syndrome	0	1
25	[72]	199323	Endophthalmitis	0	0
26	[183]	337	Fibrodysplasia ossificans progressiva (ARD)*	1	0
27	[45]	2092	Focal dermal hypoplasia	1	0
28	3	221126	Fowler syndrome	1	0
29	17	355	Gaucher disease	2	5
30	17	77260	Gaucher disease, type 2	1	4
31	17	77261	Gaucher disease, type 3	1	4
32	[154]	95509	Granulomatous hypophysitis	0	0
33	[121]	855	Hashimoto struma	1	0
34	[90]	158032	Hemophagocytic syndrome	14	1
35	[132, 152]	85458	Hereditary cerebral hemorrhage with amyloidosis	2	0
36	[132]	100006	Hereditary cerebral hemorrhage with amyloidosis, Dutch type	0	0
37	[157]	422	Idiopathic and/or familial pulmonary arterial hypertension (ARD)*	3	17
38	21	69665	Intrahepatic cholestasis of pregnancy	2	0
39	[100]	2778	Juvenile chronic recurrent multifocal osteomyelitis	0	0
40	[82]	2331	Kawasaki disease	0	1
41	[156]	1571	Knobloch syndrome (ARD)*	1	0
42	[101, 163]	530	Lipoid proteinosis (ARD)*	1	0
43	[7, 108]	538	Lymphangioleiomyomatosis	2	0
44	17	93448	Lysosomal storage disease with skeletal involvement	22	0
45	[86]	101338	Mediterranean spotted fever	0	0
46	[168]	54370	Membranoproliferative glomerulonephritis	1	0
47	[10, 127, 145]	565	Menkes disease	1	0
48	[68, 106]	2573	Moyamoya disease	1	0
49	[87, 144, 169, 172, 177, 180]	93686	Multicentric Castleman disease	0	0
50	[176]	94058	Neovascular glaucoma	1	0
51	[129]	649	Norrie disease	1	0
52	[25]	447	Paroxysmal nocturnal hemoglobinuria	0	2
53	17	85212	Perinatal-lethal Gaucher disease	1	0
54	18	563	Peripartum cardiomyopathy	0	0
55	[40]	758	Pseudoxanthoma elasticum	1	0
56	[4, 113, 157]	182090	Pulmonary arterial hypertension	0	3
57	[96, 153]	199241	Pulmonary capillary hemangiomatosis	0	2
58	[113]	71198	Rare pulmonary hypertension	0	1
59	[38]	60032	Recurrent respiratory papillomatosis	0	0
60	[40, 102, 171, 176]	90050	Retinopathy of prematurity	1	2
61	[33]	49041	Retroperitoneal fibrosis	0	0
62	[86]	102021	Rickettsiae disease	0	0
63	[17, 82]	797	Sarcoidosis	1	2
64	[81, 124]	801	Scleroderma	0	3
65	[166]	36426	Stevens-Johnson syndrome	0	0
66	[99]	3243	Sweet syndrome	0	0
67	[116, 119, 154]	536	Systemic lupus erythematosus	2	1
68	[81]	90291	Systemic sclerosis	0	3
69	[135]	93573	Thrombotic microangiopathy	0	0
70	[25, 151]	54057	Thrombotic thrombocytopenic purpura	1	5
71	[25]	90038	Typical hemolytic uremic syndrome	0	1
72	[117]	52759	Vasculitis	0	0
73	[49, 109, 129]	98668	Vitreoretinopathy (ARD)*	14	0
74	[86, 151, 175]	903	Von Willebrand disease	1	3
75	[150]	51636	WHIM syndrome	1	0
76	[82, 127, 145]	905	Wilson disease	1	4

^*ARD: angiogenic rare disease.

Since Orphanet identifies genes listed in its database such as those considered to be involved in the pathophysiology of rare diseases and because this information is extracted from the scientific literature and cross-validated, genes directly related to angiogenesis and A-RDs can be associated (i.e. those genes linked to A-RDs in the systematic review and in the same way recovered with the Gene Ontology GO term called angiogenesis; GO:0001525). In this context, we consider that diseases recovered in this way can be called “angiogenic rare diseases” and they can be retrieved from those 180 rare diseases related in some way with angiogenesis. These 27 angiogenic rare diseases are also highlighted in Table2.

The most commonly used classification of diseases is WHO ICD-10 (http://www.who.int/classifications/icd/en). Tables S2–S4 (Supplementary material) list A-RDs corresponding to subsets A, B, and C, respectively, indicating their ICD-10 when available. It is noteworthy that as many as 83 A-RDs (47 in subset A, 6 in subset B and 30 in subset C) have currently no ICD code assigned.

Genes and drugs associated to angiogenesis-related rare diseases

We manually collected 244 entrances identified as genes in Orphanet. To study the relative distribution of the set of extracted and annotated genes in the list of A-RDs, and also to know their representation in the three initial subsets (A, B, C), three categories of A-RDs where established: those currently associated to no gene, those associated to one gene, and those with two or more genes associated. The number of genes in each A-RD is highlighted in Table2. Furthermore, Tables S5 and S6 (Supplementary material) list all the A-RDs associated to a single or to more than a gene, respectively, identifying the corresponding related genes by their Orpha gene IDs.

It is interesting to note that this relationship among genes and A-RDs is not symmetrical. Tables3 and 4 list the whole set of 186 genes associated to one A-RD and 58 genes associated to two or more A-RDs, respectively, identifying the corresponding A-RDs by their Orpha rare disease IDs. Figure2 shows the distribution of the annotated genes grouped in two categories (those associated to one A-RD and those associated to two or more A-RDs in the whole set and the three subsets of A-RDs.

Table 3.

Genes associated to a single angiogenesis-related rare disease

n′	Genes	Rare disases Orpha ID
1	ACTA2	2573 (C)
2	ATF1	97338 (A)
3	ACVR1	337 (C)
4	ADAMTS13	54057 (C)
5	AP3B1	158032 (C)
6	ARMS2	279 (C)
7	APP	85458 (C)
8	ALS2	803 (C)
9	ALK	3395 (A)
10	ANG	803 (C)
11	(TATCCGGAGGGCTCGCCATGCTGCT)	94058 (C)
12	AVP	178029 (C)
13	ARSB	93448 (C)
14	AGA	93448 (C)
15	ATG16L1	206 (C)
16	ATP8B1	69665 (C)
17	ATP7A	565 (C)
18	ATP7B	905 (C)
19	ABCA4	279 (C)
20	ABCB4	69665 (C)
21	ABCC6	758 (C)
22	AIRE	3453 (C)
23	BEST1	98668 (C)
24	BLOC1S3	158032 (C)
25	BMPR2	422 (C)
26	BARD1	180250 (A)
27	BRIP1	180250 (A)
28	BCR	521 (B)
29	BRCA1	180250 (A)
30	CDH1	63443 (A)
31	CREB3L1	3394 (A)
32	CREB3L2	3394 (A)
33	Cathepsin A—CTSA	93448 (C)
34	CEBPA	519 (A)
35	CD46	2134 (C)
36	CXCR4	51636 (C)
37	CHGB	803 (C)
38	COL2A1	98668 (C)
39	COL9A1	98668 (C)
40	COL11A1	98668 (C)
41	COL11A2	98668 (C)
42	CR1	536 (C)
43	C3	2134 (C)
44	CFB	2134 (C)
45	CFI	2134 (C)
46	CBFB	519 (A)
47	CDKN1B	652 (B)
48	CDKN2A	217074 (A)
49	CST3	85458 (C)
50	CTLA4	536 (C)
51	DAO	803 (C)
52	DEK	519 (A)
53	DTNBP1	158032 (C)
54	ENG	774 (B)
55	ETV6	519 (A)
56	ERCC1	191 (B)
57	ERCC2	191 (B)
58	ERCC5	191 (B)
59	ERCC6	191 (B)
60	ERCC8	191 (B)
61	EXT1	223727 (A)
62	ECM1	530 (C)
63	FCGR3B	855 (C)
64	FLVCR2	2211 (C)
65	FBLN5	279 ((C)
66	FIG 4	803 (C)
67	FLT3	519 (A)
68	FOXC2	79383 (B)
69	FOXO1	3394 (A)
70	FZD4	98668 (C)
71	FUCA1	93448 (C)
72	GALNS	93448 (C)
73	GLA	324 (B)
74	GLB1	93448 (C)
75	GLMN	83454 (A)
76	GNS	93448 (C)
77	GUSB	93448 (C)
78	HMCN1	279 (C)
79	HGSNAT	93448 (C)
80	HPS1	158032 (C)
81	HPS3	158032 (C)
82	HPS4	158032 (C)
83	HPS5	158032 (C)
84	HPS6	158032 (C)
85	HTRA1	279 (C)
86	HYAL1	93448 (C)
87	IDS	93448 (C)
88	IDUA	93448 (C)
89	IGHG1	29073 (A)
90	ING1	67037 (A)
91	ING3	67037 (A)
92	INSM1	877 (A)
93	IRF4	29073 (A)
94	IL10	206 (C)
95	IL23R	206 (C)
96	LRP5	98668 (C)
97	LYST	158032 (C)
98	HLA-A	179 (C)
99	HLA-DRB1	797 (C)
100	MAN2B1	93448 (C)
101	MANBA	93448 (C)
102	MECOM	52688 (A)
103	MKL1	519 (A)
104	MANF	217074 (A)
105	MUTYH	63443 (A)
106	MLL	519 (A)
107	MYH11	519 (A)
108	MYST3	519 (A)
109	GNPTAB	93448 (C)
110	GNPTG	93448 (C)
111	NAGLU	93448 (C)
112	NF1	636 (B)
113	NEFH	803 (C)
114	NME1	3395 (A)
115	SGSH	93448 (C)
116	NR1H3	803 (C)
117	NR2E3	98668 (C)
118	NPM1	519 (A)
119	NUP214	519 (A)
120	NUP98	519 (A)
121	NOD2	206 (C)
122	OPTN	803 (C)
123	PAX3	3394 (A)
124	PAX7	3394 (A)
125	PHOX2B	3395 (A)
126	PON1	803 (C)
127	PON2	803 (C)
128	PON3	803 (C)
129	PTCH2	3395 (A)
130	PRF1	158032 (C)
131	PRPH	803 (C)
132	PLCE1	99977 (A)
133	PDGFRA	44890
134	PORCN	2092 (C)
135	KCNJ13	98668 (C)
136	PRLR	180250 (A)
137	PML	519 (A)
138	PSAP	355 (C)
139	RAB27A	158032 (C)
140	RAD51	180250 (A)
141	RAD51C	180250 (A)
142	RB1	668 (A)
143	RARA	519 (A)
144	RS1	98668 (C)
145	RMST	3394 (A)
146	RPS14	52688 (A)
147	RNF135	636 (B)
148	RBM15	519 (A)
149	RUNX1	521 (B)
150	RUNX1T1	519 (A)
151	SETX	803 (C)
152	STK11	2869 (B)
153	SET	519 (A)
154	NEU1	93448 (C)
155	SMAD9	422 (C)
156	SLC17A5	93448 (C)
157	SLC22A4	206 (C)
158	SLC44A4	93448 (C)
159	SOX18	79383 (B)
160	SUMF1	93448 (C)
161	SOD1	803 (C)
162	SUFU	3395 (A)
163	SUZ12	636 (B)
164	SS18	3394 (A)
165	SSX1	3394 (A)
166	SSX2	3394 (A)
167	SSX2IP	3394 (A)
168	SSX2B	3394 (A)
169	STX11	158032 (C)
170	STXBP2	158032 (C)
171	TARDBP	803 (C)
172	TEK	2451 (B)
173	TSPAN12	98668 (C)
174	THBD	2134(C)
175	TSC1	538 (C)
176	TSC2	538 (C)
177	TNFRSF10B	67037 (A)
178	UNC13D	158032 (C)
179	ABL1	521 (B)
180	VAPB	803 (C)
181	VCAN	98668 (C)
182	KRAS	217074 (A)
183	MYCN	3395 (A)
184	VWF	903 (C)
185	WT1	3394 (A)
186	ZBTB16	519 (A)

(A), (B), (C) correspond to subset A, B and C respectively.

Table 4.

Genes associated to two or more angiogenesis-related rare diseases

n°	Genes	1	2	3	4	5	6	7
		Rare diseases Orpha ID
1	PTEN	3395 (A)	180250 (A)	182067 (A)	67037 (A)	201 (B)	109 (B)	65285 (A)
2	FUS	3394 (A)	519 (A)	803 (C)	69078 (A)	99967 (A)
3	SDHD	180250 (A)	717 (A)	29072 (A)	201 (B)	877 (A)
4	TP53	3395 (A)	182067 (A)	360 (A)	217074 (A)	524 (A)
5	CHEK2	180250 (A)	223727 (A)	524 (A)	668 (A)
6	EWSR1	3394 (A)	223727 (A)	319 (A)	97338 (A)
7	GBA	355 (C)	77260 (C)	77261 (C)	85212 (C)
8	NDP	98668 (C)	190 (C)	649 (C)	90050 (C)
9	SDHB	180250 (A)	717 (A)	29072 (A)	201 (B)
10	TFE3	3394 (A)	217071 (A)	151 (A)	163699 (A)
11	VHL	217071 (A)	151 (A)	717 (A)	892 (B)
12	CFH	279 (C)	2134 (C)	54370 (C)
13	DMBT1	3395 (A)	182067 (A)	360 (A)
14	EGFR	3395 (A)	182067 (A)	360 (A)
15	FH	217071 (A)	151 (A)	523 (A)
16	GLTSCR1	3395 (A)	182067 (A)	360 (A)
17	GLTSCR2	3395 (A)	182067 (A)	360 (A)
18	GLI1	3395 (A)	182067 (A)	360 (A)
19	LRRN2	3395 (A)	182067 (A)	360 (A)
20	YEATS4	3395 (A)	182067 (A)	360 (A)
21	OGG1	217071 (A)	151 (A)
22	ACVRL1	422 (C)	774 (B)
23	APC	3395 (A)	733 (A)
24	ASPSCR1	3394 (A)	163699 (A)
25	AGGF1	2346 (C)	90308 (B)
26	BRCA2	180250 (A)	217074 (A)
27	CTNNB1	3395 (A)	88673 (A)
28	COL1A1	3394 (A)	31112 (A)
29	COL18A1	98668 (C)	1571 (C)
30	DIRC1	217071 (A)	151 (A)
31	DIRC2	217071 (A)	151 (A)
32	ETV4	223727 (A)	319 (A)
33	ETV1	223727 (A)	319 (A)
34	FLT4	79383 (B)	77240 (B)
35	FLCN	217071 (A)	151 (A)
36	FHIT	217071 (A)	151 (A)
37	FLI1	223727 (A)	319 (A)
38	GJC2	79383 (B)	77240 (B)
39	HSPBAP1	217071 (A)	151 (A)
40	JAK2	824 (B)	729 (B)
41	MET	217071 (A)	88673 (A)
42	MEN1	652 (B)	913 (B)
43	NOTCH3	136 (C)	95509 (C)
44	PRCC	217071 (A)	151 (A)
45	PALB2	180250 (A)	217074 (A)
46	PDGFB	3394 (A)	31112 (A)
47	RASA1	2346 (C)	137667 (A)
48	RET	717 (A)	1332 (A)
49	RNF139	217071 (A)	151 (A)
50	SMAD4	217074 (A)	774 (B)
51	SDHAF2	717 (A)	29072 (A)
52	SDHA	717 (A)	29072 (A)
53	SDHC	717 (A)	29072 (A)
54	SMARCA4	3394 (A)	69077 (A)
55	SMARCB1	3394 (A)	69077 (A)
56	TMEM127	717 (A)	29072 (A)
57	ERG	223727 (A)	319 (A)
58	KIT	44890 (A)	98292 (A)

(A), (B), (C) correspond to subset A, B and C respectively.

Fig 2.

Relative distribution of genes associated to angiogenesis-related rare disease. Percentages of genes belonging to described subsets of A-RDs: A (A-RDs with cancerous phenotype in all their features), B (A-RDs with cancerous phenotype only in some of their features) and C (A-RDs without cancerous phenotype). Horizontal-axis represents the distribution of genes in the different subsets. Color code: blue, genes related to one A-RD; brownish, genes related to two or more A-RDs; dark grey: total genes related to A-RDs.

In the case of drugs, in this study 285 entrances were manually identified in Orphanet database as orphan drugs. As in the case of genes, three categories of A-RDs where established: those currently associated to no drug, those associated to one drug, and those with two or more drugs associated. The number of drugs in each A-RD is highlighted in Table2. Furthermore, Tables S7 and S8 (Supplementary material) list all the A-RDs associated to a single or to more than a drug, respectively, identifying the corresponding related drugs by their Orpha drug IDs. As in the case of genes, the relationship A-RDs-drugs is also asymmetrical. Tables S9 and S10 list the whole set of 198 drugs associated to one A-RD and 87 drugs associated to two or more A-RDs, respectively, identifying the corresponding A-RDs by their Orpha rare disease IDs. Figure3 shows the distribution of the annotated drugs grouped in two categories (those associated to one A-RD and those associated to two or more A-RDs) in the whole set and the three subsets of A-RDs.

Fig 3.

Relative distribution of Orphan drugs associated to angiogenesis-related rare disease. Percentages of drugs belonging to described subsets of A-RDs: A (A-RDs with cancerous phenotype in all their features), B (A-RDs with cancerous phenotype only in some of their features) and C (A-RDs without cancerous phenotype). Horizontal-axis represents the distribution of drugs in the different subsets. Color code: blue, drugs related to one A-RD; brownish, drugs related to two or more A-RDs; dark grey: total drugs related to A-RDs.

Discussion of the literature search and orphanet analysis

Bibliographic systematic review

Our bibliographic systematic review (see Fig.1) has allowed us to select 187 references (see bibliography in Supplementary material) and 180 A-RDs (that is, 180 rare diseases related with the neovascularization process, see Table2A–C). This systematic review has also made possible the extraction of a great amount of data in an exhaustive and trustworthy manner. In the present work, these extracted data could be synthetized, validated and interrelated through the use of a reproducible methodology, based in PRISMA statements 20,21 (see PRISMA checklist in Table S1 and PRISMA flow diagram in Figure S1). When we recovered those A-RDs that are cited three or more times in our set of selected references (29 of the 180 A-RDs), we found that in most cases vascular diseases (or malformations) or angioproliferative disorders were retrieved, with the exceptions of Multicentric castleman disease (OPRPHA93686), Multiple myeloma (ORPHA29073), Primary effusion lymphoma associated with HIV infection (ORPHA99923) and Primary effusion lymphoma (ORPHA48686). Renal cell carcinoma (ORPHA217071) was the angioproliferative disease more times referenced (in fact, it is mentioned in 14 of the 187 selected references included in supplementary material).

On the other hand, a text mining analysis has been used as an automatic and independent validation of the results achieved in the systematic review. We can observe that the enriched MeSH terms of the 187 bibliographic references, obtained from the systematic review, are notably related to angiogenesis and pathological conditions (see Table1). These results of the text mining analysis confirm that our selection of the bibliography has consistent information related to angiogenesis and biological process involved in the pathogenesis. Under these conditions, more than a half of PMIDs linked to MeSH terms related to pathologies (i.e. Neovascularization, Pathologic, Herpesvirus 8, Macular Degeneration, Pathologic-von Hippel–Lindau Disease, lymphangioleiomyomatosis, Renal Cell Carcinoma, Hereditary Hemorrhagic Telangiectasia, Hemangioendothelioma, POEMS Syndrome, Essential osteolysis, Capillary Hemangioma Kaposi Sarcoma, Rare Diseases and Lipoid proteinosis of Urbach and Wiethe) match with those PMIDs that are linked to MeSH terms related to angiogenesis (Angiogenesis inhibitors, Vascular Endothelial Growth Factor A, Thalidomide, Vascular Endothelial Growth Factors, Angiogenic Proteins, Vascular Endothelial Growth Factor Receptors). It is interesting to note that only three PMIDs are indicated for the term called “Rare disease”, which highlights the lack of identification with this type of disease in the scientific literature (see Table1).

Initial classification of angiogenesis-related rare diseases

Orphanet has its own classification of rare diseases, based on a hierarchy of descriptive categories. These categories are pathological descriptions based in published scientific data and information provided by experts in the field. These pathological descriptions are referred to as manifestations along the tables presented in this work. The close relationship between angiogenesis and tumor progression was used for the initial classification of A-RDs into three differentiated subsets (see Table2). The analysis of this classification confirmed that this procedure gave rise to a consistent separation. The dominant subset was “rare neoplasias” (subset A), as expected. Concerning A-RDs included in subset B, they are mostly vascular malformations (as angiomas and hemangiomas), as well as dysplasias and hamartomas. They are non neoplastic pathologies associated to an increased risk to develop tumors. Finally, subset C included a whole array of non-tumoral rare diseases tightly related with (and, in many cases, dependent on) angiogenesis.

On the other hand, the systematic review of the collected data allowed us to detect a number of incoherencies in the Orphanet classification of rare diseases. Some of them are highlighted here:

• Cerebral cavernous malformations (ORPHA164) are rare brain vascular malformations that are also named as brain cavernous angioma. The term “angioma” showed concurrence with this and other search terms included in the three subsets, in spite of the fact that an angioma is not a tumor 24. Our analysis led to include cerebral cavernous malformations (ORPHA164) within subset A, although the Orphanet classification for this disease remained undefined (“This disease will be assigned to a classification in the near future”). Furthermore, the clinical description of this disease in Orphanet was unclear enough as to make possible its inclusion in any of the other subsets (either B or C). On the other hand, ICD-10 codes this disease as Q28.3 (“Congenital malformations, deformations and chromosomal abnormalities”), as it is also the case for other angiomas (glomuvenous malformation (ORPHA83454), among others).

• POEMS syndrome (ORPHA2905) is a rare paraneoplasia that only presented concurrency with search terms in some of their classifications. However, it is a multisystemic disease in most of the cases associated to osteosclerotic myeloma. This is the main reason why it was finally included into subset A, although there were also reasons to include it into subset B. ICD-10 codes it within R16 (“Symptoms, signs and abnormal clinical and laboratory findings, not elsewhere classified”).

• Chronic myeloid leukemia (ORPHA521) appears included in subset B (Table2) because at the moment in which this systematic review and analysis was carried out Orphanet offered four general categories of classification (namely, classification of hematopoietic and lymphoid tumors, classification of disease with platelet number and function anomalies, Orphanet classification of rare hematological diseases and Orphanet classification of rare tumors) for this disease, one of which (namely, classification of disease with platelet number and function anomalies) had no concurrence with search terms. However, updates arranged in Orphanet after our systematic review and analysis offer only two general classification for this disease (namely, Orphanet classification of rare hematological diseases and Orphanet classification of rare tumors), which would be consistent with the inclusion of this disease within subset A. In fact, ICD-10 codes this disease as C92.1 (“Neoplasms”).

These previously commented cases and others reveal the importance of establishing correct and unambiguous denominations to these diseases in databases such as Orphanet. A systematic, unambiguous classification and the actual way in which the information is documented and transmitted can help physicians during health assistance. We have also detected that ICD-10 have no code assigned for 46% (83 out of 180) of the A-RDs listed (see Tables S2–S4 in Supplementary material). The announced release of ICD-11 (which will include a systematic classification based on worldwide accepted clinical criteria) should standardize the classification of rare diseases. This undoubtedly will make it easier the documentation procedure and the curation of the collected information concerning this kind of vaguely described disorders.

It should be mentioned that several classifications of rare diseases available in Orphanet at the moment of carrying out this systematic review were deleted from Orphanet website in more recent actualizations of the site. This was the case of Orphanet classification of red cell diseases, classification of hematopoietic and lymphoid tumors and classification of disease with platelet number and function anomalies. The recent emergence of a new category in the Orphanet classification: Inherited cancer-predisposing syndrome (ORPHA140162) should also be mentioned.

As mentioned, from the 180 selected A-RDs, these 27 highlighted with an asterisk in Table2 can be considered as angiogenic rare diseases. Three of them have same genetic and molecular profiles closely related to angiogenesis: Angio-osteohypertrophic syndrome (ORPHA2346), Neurofibromatosis type I (ORPHA636) and Rendu-Osler-Weber disease (ORPHA774). Orphanet also includes information about this. The other angiogenic rare diseases are pathologies whose genetic and molecular profiles are related to certain aspects of angiogenesis such as VEGF expression, anti-angiogenic therapies or related with vascular proliferation process, among others. In many of these cases further investigation is required. A problem arises with Orpha IDs that are classified in Orphanet as diseases that group other diseases. Under these conditions, since no distinction is made by Orphanet and only in some cases it is indicated correctly (i.e. “This term does not characterize a disease but a group of diseases. To learn about the diseases included under this term, search for in the Classifications menu”), we think that many other diseases could be retrieved. In the case of A-RDs that group other diseases, Orphanet does not only list those genes that are being shared among all diseases belonging to that category, but it also contains all the genes that are within that class of diseases. In this context, no genetic profile is identified in these categories of classification. As mentioned, a classification made in this way is useful when grouping features around a category of diseases and allows a proper allocation of patient, but it says little about its genetic and molecular profiles. No information is displayed in the summary of almost a third of these A-RDs and only two of these that group other diseases are identified (i.e. An Orphanet summary for this disease is currently under development. However, other data related to the disease are accessible from the Additional Information menu located on the right side of this page). The case of Brain tumor (ORPHA3395) is clearly a kind of pathology that groups other diseases. In Oprhanet it is identified as: “This disease will be assigned to a classification in the near future”. For this disease, currently no list of genes, and no classification is indicated in Orphanet.

Another problem for systematic studies is also the way in which Orphanet updates and corrects its database. For instance, up to four angiogenic rare diseases were outdated in the course of our systematic review. Glioma, now called Glial tumor (ORPHA182067), does not remain associated with the gene called PTEN, which in its original link (MIN ID605 691) is identified as a tumor suppressor. Oligodendroglial tumor (ORPHA46484) is linked in UniProt (ID60484) too and it is just a subcategory of glial tumor. In addition, two genes are listed for Brain tumor: PTEN and CTNB1. On the other hand, two genes (PML and RBM15) were listed for Acute myeloid leukemia (ORPHA519). Currently, the symbol RBM15 (RNA binding motif protein 15) does not appear in Orphanet database. In Uniprot (ID Q96T37), Acute megacaryoblastic leukemia (ORPHA518) is listed as an Orphan disease.

Genes and drugs associated to angiogenesis-related rare diseases

Figure4 shows frequence distributions of A-RDs taking into account the number of genes or the number of drugs to which they are related (information abstracted from Tables4 and S5–S10. As Figure4 shows, approximately half of A-RDs are linked to no gene and no drug. The highest percentage of A-RDs linked to two or more genes or drugs corresponds to subset A. This reflects the actual current state of knowledge in this research area, which—as expected—is much higher in neoplastic A-RDs (those included in subset A).

Fig 4.

Relative distribution of angiogenesis-related rare diseases associated to genes and Orphan drugs. Left panels. Up, the percentages of A-RDs associated to drugs are shown. Down, the percentages of the three described subsets associated to genes are shown. Subsets: A (angiogenesis-related rare diseases with cancerous phenotype in all their features), B (cancer-related, angiogenesis-related rare diseases with cancerous phenotype only in some of their features) and C (angiogenesis-related rare diseases without cancerous phenotype). Right panels. Up, the percentages of A-RDs associated to drugs are shown. Down, the percentages of the same three A-RDs groups described above, here associated to genes.

Lysosomal storage disease with skeletal involvement (ORPHA93448) is the A-RD linked to the highest number of genes (22), but at the same time is linked to no drug. On the other hand, both Acute myeloid leukemia (ORPHA519) and Glioblastoma (ORPHA360) are the two A-RDs with the highest number of linked drugs (33 in each case), being the third and the 12th respectively according to their linked genes (see Table2 and Table S6).

As Figure2 shows, most of the genes are linked to only one A-RD. The majority of those genes linked to two or more A-RDs in fact are related with A-RDs of the subset A. A similar situation is found in the case of drugs (Fig.3).

Phosphatase and tensin homolog (mutated in multiple advanced cancers 1)—PTEN is one of the genes with more links to A-RDs (Table4).

It is noteworthy that Orphanet updated versions used when this systematic review and analysis was carried out identified the entrance Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) as both a gene (which is obviously false) and as a drug (see Table3 and Table S9). In both cases, this entrance was linked to an only A-RD: to Neovascular glaucoma (ORPHA94058) in Table3 and to Retinopathy of prematurity (ORPHA90050) in Table S9. We have maintained both entrances according to the results yielded by our systematic methodology. This highlights that this systematic approach allows for a more correct curation of the collected data. In more recent updates of Orphanet some of the detected error have been corrected.

Concluding remarks

1. The obvious great current interest in angiogenesis and in rare diseases demanded a systematic review of the current state of knowledge in the Boolean intersection of these two research areas, namely, the still not well defined set of angiogenesis-related rare diseases. The present review report contributes to satisfy such a demand.

2. Current technology allows researchers to have access to great databases containing overwhelming amounts of data. Furthermore, there are a number of biocomputational tools that makes it easier the access, extraction and analysis of biological data contained in databases and they can enhance the molecular knowledge emerged from the systematic review results. We claim that the critical use of such tools makes possible and affordable to carry out systematic reviews of the current state of knowledge of specific research areas. These systematic reviews are aimed to add value to the classical bibliographical reviews thanks to their potential to extract new emergent information. The present systematic review on angiogenesis-related rare diseases can be considered an initial contribution in this way.

3. Herein we propose a simple classification of angiogenesis-related rare diseases trying to discriminate the tight relationships of those linked to cancer.

4. We have detected that both the Orphanet classification of rare diseases and the WHO International Classification of Diseases ICD-10 urgently require deep revisions and updates.

5. Much more research is urgently needed for the identification of genes and drugs related to many angiogenesis-related rare diseases and for the exploration of new diagnostic, prognostic and therapeutic procedures.

6. Orphanet database is a useful resource for all scientists and physicians engaged with rare diseases, as well as for patients’ associations. However, form a scientific point of view, Orphanet still lacks of an actual semantic classification of rare disease. Furthermore, a deep upgrade of the scientific information contained in Orphanet is urgently required.

7. This systematic review of available literature on angiogenesis rare diseases has ordered and connected the currently available but up to now dispersed wealth of information on the topic, as reflected by the full set of accompanying figures and tables. This information will be useful for those interested in knowing the full set of described angiogenesis-related rare diseases, and what genes and drug treatments a specific angiogenesis-related rare disease shares with other ones. In particular, this information can be a very useful start point for new, deep reviews focused on concrete angiogenic rare diseases.

8. Taking the ordered information contained in the accompanying figures and tables of the present work as a starting point, functional enrichment and network analysis tools could be used in the near future to make predictions of new gene targets, drugs and/or treatments for some rare diseases based in their shared spectra with the full set of angiogenesis-related rare diseases herein reviewed.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

All the five authors were personally involved bibliographic research and discussion of collected data as well as in the design of the manuscript contents. L.R.C. carried out the primary bibliographic search. A.R.P. was involved in the text-mining analysis with SciMiner. A.R.Q. and F.S.J. critically reviewed the first draft of the manuscript and contributed to its definitive version. M.A.M. supervised the whole procedures and wrote the manuscript.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Figure S1. PRISMA flow diagram of the bibliographic systematic review.

Table S1. PRISMA checklist

Table S2. Analysis of the angiogenesis-related rare disease in subset A according to International Classification of Diseases

Table S3. Analysis of the angiogenesis-related rare disease in subset B according to International Classification of Diseases

Table S4. Analysis of the angiogenesis-related rare disease in subset C according to International Classification of Diseases

Table S5. Angiogenesis-related rare diseases associated to a single gene

Table S6. Angiogenesis-related rare diseases associated to two or more genes

Table S7. Angiogenesis-related rare diseases associated to a single drug

Table S8. Angiogenesis-related rare diseases associated to two or more drugs

Table S9. Drugs associated to a single angiogenesis-related rare disease

Table S10. Drugs associated to two or more angiogenesis-related rare diseases

Data S1. Selected bibliographic references related to the 187 angiogenesis-related rare diseases covered by this work.