Table 4. Some known miRNA of which read number was more than 100,000 in this study.
| miR name | miR seq | Rep_miR ID | R-NE | P-NE |
|---|---|---|---|---|
| oar-miR-10a_R+1_1ss12TA | TACCCTGTAGAACCGAATTTGT | oar-mir-10a | 153958.5 | 657181.3 |
| oar-miR-10b_L+1R-1 | TACCCTGTAGAACCGAATTTGT | oar-mir-10b | 160641.5 | 718168.0 |
| oar-miR-26a | TTCAAGTAATCCAGGATAGGCT | oar-mir-26a | 142846.7 | 330581.6 |
| oar-let-7a | TGAGGTAGTAGGTTGTATAGTT | oar-let-7a | 151415.4 | 223063.1 |
| aja-miR-143_1ss22GT | TGAGATGAAGCACTGTAGCTCT | aja-mir-143 | 289634.3 | 1866274.0 |
Note: rep_miR ID was the representative known miRNA ID. R-NE represented the normalized expression level of miRNAs in the small RNA library generated from receptive endometrium of Xinong Saanen dairy goats. P-NE represented the normalized expression level of miRNAs in the small RNA library generated from pre-receptive endometrium of Xinong Saanen dairy goats.