TABLE 2.
Prediction of CTCF binding in various HPV types and relative in vitro binding affinity
| Class, type,a and predicted motif | Fragment tested | Name | Motif sequence | Confirmed in vitro | Relative strength of binding |
|---|---|---|---|---|---|
| High risk | |||||
| HPV18 (AY262282.1) | |||||
| 843 | 754-943 | 18_1 | ATTCCAGCAGCTGTTTCTGA | No | ND |
| 1205 | 1102-1297 | 18_2 | CCATTAGGGG | No | ND |
| 2989 | 2926-3117 | 18_3 | AAACCACCAGGTGGTGCCAG | Yes | Strongb |
| 3487 | 3381-3575 | 18_4 | CGGTGAGGGG | No | ND |
| 3620 | 3527-3718 | 18_5 | TTGCCTGTAGGTGTAGCTGC | Yes | Medium |
| 4505 and 4537 | 4440-4638 | 18_6 and 18_7 | CGTCCCCCAGTGGT/GTAACAATAGATGGGTCTGT | Yes | Two medium bands |
| None | 4947-5155 | 18_8 | NA | No | ND |
| None | 5045-5253 | 18_9 | NA | No | ND |
| 5473 | 5381-5577 | 18_10 | CATACAGAGG | Yes | Medium |
| 5767 | 5655-5850 | 18_11 | CACCACCTGCAGGA | Yes | Medium |
| HPV16 (NC_001526.2) | |||||
| 1282 | 1216-1405 | 16_1 | AACTCAGCAGATGTTACAGG | No | ND |
| 2915 | 2852-3049 | 16_2 | TAACCACCAAGTGGTGCCAA | Yes | Strongb |
| 5118 | 5000-5207 | 16_3 | CGCCTAGAGG | Yes | Weak |
| 6127 | 6051-6278 | 16_4 | CCTATAGGGG | Yes | Weak |
| 6514 | 6426-6600 | 16_5 | GAACCACTAGGTGTAGGAA | Yes | Weak |
| 6859 | 6772-6957 | 16_6 | CTCCCCCAGGAGGC | Yes | Weak |
| HPV31 (J04353.1) | |||||
| 615 | 534-713 | 31_1 | ATAACAGTGGAGGTCAGTT | No | ND |
| 885 | 804-1008 | 31_2 | TGGGGAGGGG | No | ND |
| 1093 | 1029-1200 | 31_3 | CATGCAGAGG | No | ND |
| 1277 | 1182-1374 | 31_4 | AACGCAGCAGATGGTACAGG | No | ND |
| 2332 | 2230-2406 | 31_5 | CAACCACTGGCTGATGCTAA | No | ND |
| 2412 | 2357-2531 | 31_6 | AATGCACTAGATGGCAACC | Yes | Strongb |
| 2853 | 2801-3015 | 31_7 | TAACCACCAGGTGGTGCCAG | Yes | Strongb |
| None | 2894-3093 | 31_8 | NA | No | ND |
| 5179 | 5077-5273 | 31_9 | CCTTTAGGGG | Yes | Strong |
| 6431 | 6354-6540 | 31_10 | CTACACCTAGCGGC | Yes | Medium |
| Low risk | |||||
| HPV6b (NC_001355.1) | |||||
| 1357 | 1251-1460 | 6b_1 | CATACAGAGG | No | ND |
| None | 2801-3007 | 6b_2 | NA | No | ND |
| None | 2887-3101 | 6b_3 | NA | No | ND |
| 4789 | 4715-4913 | 6b_4 | TGTGCAGGGG | No | ND |
| 5018, 4987 | 4913-5102 | 6b_5 and 6b_6 | CTATCACTAGATGATACCA/CCTATAGAGG | No | ND |
| 5424 | 5317-5515 | 6b_7 | GCAGCCACAAGAGGGTGCAT | Yes | Strong |
| 6109 | 5995-6199 | 6b_8 | CAGCCATTAGGTGTGGGTGT | No | ND |
| 6263 | 6179-6382 | 6b_9 | CCCAAAGGGG | Yes | Medium |
| 7205, 7256 | 7155-7380 | 6b_10 and 6b_11 | CGAATAGAGG/CGTTTAGGGG | No | ND |
| HPV11 (FR872717.1) | |||||
| 1357 | 1295-1494 | 11_1 | CATAGAGAGG | No | ND |
| None | 2801-3003 | 11_2 | NA | No | ND |
| None | 2900-3104 | 11_3 | NA | No | ND |
| 4058 | 3930-4153 | 11_4 | TGCAAAGGGG | Yes | Medium |
| 4781 | 4709-4898 | 11_5 | TGTGTAGGGG | No | ND |
| 4920 | 4844-5041 | 11_6 | CCACCTGTGGAGGCCAGTG | Yes | Weak |
| 5415 | 5330-5501 | 11_7 | GCAGCCACTAGAGGGTGCAG | Yes | Strong |
| 6310 | 6243-6428 | 11_8 | GTTCCAACGGGGGGCAGTC | Yes | Weak |
| 6635 | 6544-6738 | 11_9 | GAGCCACTAGGTGTATGTA | Yes | Weak, smear |
| 6979 | 6872-7074 | 11_10 | CCTCCACCAAATGGTACACT | No | ND |
The accession number of each HPV genome analyzed is indicated. The position in the viral genome of the first nucleotide of each predicted motif is given along with the specific fragment tested by EMSA. Where a fragment was tested that did not contain a predicted motif, no position is given (none). Each fragment tested is named by HPV type followed by the order of position in the genome starting at position 1 in the URR. The sequence of each motif is given (NA indicates that a motif was not predicted). Fragments were tested for binding in vitro by EMSA. The relative strength of binding to each fragment was assessed qualitatively by comparison to the proportion of c-Myc-positive control DNA bound by CTCF in the same assay (weak, <50% binding; medium, 50 to 75% binding; strong, >75% binding; ND, none detected). All EMSA experiments were repeated at least three times, and the strength of binding reflects the relative binding strength achieved in all repeats.
CTCF binding site within the E2 ORF that is conserved in all high-risk HPV types tested.