Figure 2.
Prothrombin and Thrombin are expressed in the brain. (A) Prothrombin mRNA measured by (RT)qPCR in cerebellum, hippocampus and cerebral cortex of C57BL/6J mice (primers: 5′ CCGAAAGGGCAACCTAGAGC, 5′ GGCCCAGAACACGTCTGTG). The results were normalized to HPRT gene expression within the same cDNA sample and calculated using the ΔCT method with values being expressed as 2−ΔCt. (B) Immunostaining for thrombin (Santa Cruz Biotech, goat polyclonal IgG, cleaved thrombin HC (m361), sc-23335; dilution 1:100 in PBS-based solution) and NeuN (Millipore, mouse monoclonal, MAB377, dilution 1:1000 in PBS-based solution) in the dorsal hippocampus of adult C57BL/6J-mice. Thrombin labeling is predominantly detected in the pyramidal cell layer (PCL) of CA1. The fiber-layers (e.g., stratum radiatum, rad) display weaker but more clustered immunohistochemical signal for thrombin. Scale bar at low magnification = 300 μm; scale bar at higher magnification = 20 μm.