Table 1.
Baseline Demographics and Mutations in the acid alpha-glucosidase (GAA) gene in 13 Children with Infantile Pompe Disease Treated with Enzyme Replacement Therapy (ERT)
| Case | Gender | Race | Age at Diagnosis (months) |
Age at first ERT infusion (months) |
Allele 1 cDNA change (amino acid change) |
Allele 2 cDNA change (amino acid change) |
|---|---|---|---|---|---|---|
| Classic Infantile Pompe Cases | ||||||
| 1 | M | Asian Indian |
1 | 3 | c.1933G>A (p.Asp645Asn) | c.1933G>A (p.Asp645Asn) |
| 2 | F | H | 3 | 5 | c.1802C>T (p.Ser601Leu)a | c.1099T>C (p.Trp367Arg) |
| 3 | M | H | 7 | 7 | c.2297A>C (p.Tyr766Ser) | c.2297A>C (p.Tyr766Ser) |
| 4 | M | C | 2 | 2 | c.1933G>A (p.Asp645Asn) | c.1933G>A (p.Asp645Asn) |
| 5 | F | C | 6 | 6 | c.655G>A (p.Gly219Arg) | c.655G>A (p.Gly219Arg) |
| 6 | M | C | 0 | 1 | c.525delT (p.Glu176ArgfsX45) | c.1642G>T (p.Val548Phe)b c.1880C>T (p.Ser627Phe)b |
| 7 | M | AA | 1 | 1 | c.2560C>T (p.Arg854X) | c.2560C>T (p.Arg854X) |
| 8 | M | AA | 6 | 6 | c.1082C>T (p.Pro361Leu) | c.953T>C (p.Met318Thr) |
| 9 | M | C | 1 | 1 | c.307T>G (p.Cys103Gly) | c.2219_2220delTG (p.Val740GlyfsX55) |
| 10 | F | H | 4 | 6 | c.1195-18_2190-20del (p.Asp399ValfsX6) | c.1195-18_2190-20del (p.Asp399ValfsX6) |
| 11 | F | AA | 5 | 6 | c.2560C>T (p.Arg854X) | c.2560C>T (p.Arg854X) |
| Atypical Infantile Pompe Cases | ||||||
| 12 | M | AA | 15 | 16 | c.-32-17_-32-10delins TCCCTGCTGAGCCTCCTACAGGCCTCCCGC (presumably affects splicing) |
c.1447G>A (p.Gly483Arg) |
| 13 | M | C | 8 | 20 | c.525delT (p.Glu176fsX45) | c.-32-13T>G |
AA, African American; C, Caucasian; F, Female; H, Hispanic; M, Male.
a
This patient is also heterozygous for the GAA pseudodeficiency alleles, p.[Gly576Ser;Glu689Lys.]
b
Predicted based on PolyPhen-2: http://genetics.bwh.harvard.edu/pph2/
Mutation nomenclature is written to conform to the recommendations of the Human Genome Variation Society (www.hgvs.org).
References for previously published mutations are available from the Pompe disease mutation database (www.pompecenter.nl; Erasmus Medical Center, Rotterdam).