Skip to main content
. 2015 Apr 28;3:e919. doi: 10.7717/peerj.919

Figure 3. Alternative splicing and putative alternative transcriptional start site in AT3G17120, a gene of unknown function.

Figure 3

(A) Visualization of RNA-Seq read alignments from leaf (L2, L1) and pollen (P3). Locations of PCR primers are indicated on the coordinates track. Primer sequences from left (5′) to right (3′) were AGAATCCGCCATTTTCTCCT (F1), CCTTGCTTCAAGCCCGAGAT (F2), and TTCCCATTATCTCCCCAGATT (R). (B) Gel electrophoresis of PCR products from amplifying pollen (P1, P2, and P3) and leaf (L1, L2) cDNAs in reactions that included primers F1, F2, and R. Corresponding model of alternative splice variants to right of gel. Estimated fragment size from gel and theoretical fragment size based on splice model found to left and right, respectively, in base pairs (bp). Asterisk indicates p-value less than 0.05, double asterisk less than 0.01.