Table 1.

Summary of transcriptional regulation of the tenascin gene promoters. For each publication cited, the species of the promoter analyzed, the transcription factor(s) over-expressed or growth factors added, the response elements and their sequences and relative position to the TSS are listed together with a short description of the main experimental evidence provided

Gene	Promoter species	Transcription factor overexpressed or factors added	Response element	Sequence	Position	Functional assays
TNC	Chicken 24				−3986 to + 121	3986bp more active than 721bp promoter in chicken embryo fibroblasts. 3986bp promoter active in human U251MG cells, but not in HT1080 cells.
	Chicken 36	EVX1 (mouse)	TRE/AP1	CTGAGTCAT	−281 to −273	Reporter activation in NIH3T3 cells and inactivation by mutation of response elements.
	Chicken 36		HBS 1	TAATGATGAT	−1354 to −1345	In vitro binding assay with ftz homeodomain.
			HBS 2	TAATGATTCT	−1369 to −1360
	Chicken 63		AP1	CTGAGTCAT	−281 to −273	Reporter activation in chicken embryo fibroblasts; deletion of response element.
			ECM		−570 to −469	Reporter activation on attached but not floating collagen gels; transfer of response to SV40 promoter
	Mouse 23				−247 to + 147	247bp promoter construct was more active than longer constructs in NIH3T3 and chicken fibroblasts
	Mouse 39	POU3F2 (BRN2)	octamer	ATGCAATG	−201 to −193	Reporter activation in mouse mouse N2A cells, but not in rat C6 cells. Binding assays (EMSA, footprint).
			NF1	TGGCGGCGCGCCT	−187 to −165	Inactivation of reporter activity by mutation of response element in N2A, C6 and NIH3T3 cells.
		EGR1 (KROX-24)	KROX20/24	GCGGGGGCG	−256 to −248	In vitro binding assays. Presence of element represses reporter in N2A cells, but not in NIH3T3 or C6 cells.
	Mouse 42,43	PRRX1 (PRX1)	HBS	CATTAC	−57 to −52	Reporter activation in rat A10 vascular SMCs and RFL-6 lung fibroblasts, EMSA and supershift.
	Mouse 58	MKL1	SRE (CArG)	CTATTTATGG	−1414 to −1423	SRF-dependent reporter activation in NIH3T3 cells and inactivation by mutation of response elements.
		MKL1mutB1			−247 to + 147	SRF-independent SAP domain dependent promoter activation by cyclic strain; ChIP
	Mouse 59	MKL1 MKL1mutB1			−247 to + 147	SRF-independent SAP domain dependent promoter activation in HC11 mammary epithelial cells Transcipts induced in SOX4-transfected LNCaP cells.
	Human 86	SOX4
	Human 20				−220 to +79	220bp promoter more active than longer constructs in SK-Mel-28 and InR1-G9 cells. Positive effect of first 20bp of first exon; inclusion of 1338bp of the first intron in the long promoter construct activates the reporter in SK-Mel-28, but not InR1-G9 cells.
	Human 37	OTX2	OTS	TAATCC	−530 to −525	In vitro binding assays.
	Human 38	OTX2	OTS	TCTAATCCC	−531 to −523	Reporter repression in U87-MG human glioblastoma cells; EMSA and binding studies.
	Human 78	TGF-β and SMAD3 and 4ETS1	CAGA1CAGA2EBS1	TCTGGCAGAGTTCC	−66 to −62−43 to −39−121 to −118	Reporter activation in human dermal fibroblasts in a complex with CBP-300; mutation of response elements; DNA affinity precipitation; Co-IP`s of complexes.
			EBS4	GGAA	−39 to −36
		SP1	SBS2	GGC	−60 to −58
			SBS3	GGA	−39 to −37
TNC	Human 79	PDGF and ETS1,2 and SP1	EBS1EBS3EBS4SBS2	TTCCGGAAAGGATGGAAGGC	−121 to −118−76 to −68−39 to −36−60 to −58	Reporter activation in human dermal fibroblasts after PDGF stimulation; mutation of response elements; overexpression of dominant negative TFs; Co-IP`s of complexes
			SBS3	GGA	−39 to −37
		PDGF and FLI1	SBS2SBS3	GGCGGA	−60 to −58−39 to −37	Abrogation of PDGF-induced reporter expression in human dermal fibroblasts
	Human 84	EWS-FLI; EWS-ERG (EWS-ETS)	EBS1–4	GGAA	−130 to −30	Reporter activation in H1299 cells. Endogenous transcripts induced by EWS-ETS, but not FLI or ERG
	Human 85	JUNRELA (p65)	GCN4NFkB	TGAGTGGGGAATTCCT	−149 to −144−214 to −207	Synergistic reporter activation; mutation of response elements EMSA; transcripts induced by Jun overexpression in rat embryo fibroblasts.
	Human 92	NOTCH2	RBPJk	GTGGGAA	−79 to −73	Reporter activation in Hs683 cells and inactivation by mutation of response element, or mutation of NOTCH2.
	Human 83	GATA6		TTATCC	−467 to −462	Reporter repression in human dermal fibroblasts (both basal and IL-4 or TGF-β induced); mutation of binding element; ChIP
	Human 62	NFKBIA (IkBα); IKBKB (IKK-β)	NFkB	GGGAATTCCT	−214 to −207	Deletion of binding element inhibits promoter activation; EMSA; Overexpression of dominant negative regulators of NFkB inhibit strain-induced promoter activation in neonatal rat cardiac myocytes.
TNR	Mouse 101				−167 to +435	167bp promoter was sufficient for full activity of reporter expression in cell lines of neural or glial origin but not in NIH3T3 and P19 teratocarcinoma cells.
	Human 99				−57 to +40	57bp promoter was sufficient for full activity of reporter expression in cell lines of neural or glial origin but not in SK-MEL28 and HeLa cells.
TNXB	Mouse 124				−150 to +333	More active than longer or shorter constructs in mouse L and human 293Tcells
			SP1	GGGAGG	−145 to −150	Mutation of binding element reduces reporter activity; EMSA and supershifts.
	Human 121				−181 to +88	Higher activity in HT1080 cells than longer or shorter constructs; TSS in HT1080 cells and fibroblasts at +46bp.
		SP1, SP3	SP1/3	GGG…GGG…GGG…GGG…CCC	−33 to −76	Activation of 311bp and 181bp reporter constructs in Drosophila S9 cells. Mutation of binding sites inhibits promoter activity; EMSA and supershifts.