| GATA-1 forward primer: | 5′ CAGCATCTTCTTCCACTTCC |
| GATA-1 reverse primer: | 5′ AGGCATAAGATGGCTGACAG |
| OPG forward primer: | 5′ CCGAGTGTGTGAGTGTGAGG |
| OPG reverse primer: | 5′ CCAGCTTGCACCACTCCAA |
| GAPDH forward primer: | 5′ CGTGGGGCTGCCCAGAACAT |
| GAPDH reverse primer: | 5′ TCTCCAGGCGGCACGTCAGA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.