Table 1.
Oligo name | Oligo sequence (5′-3′) | Description (cDNA nucleotide binding site) |
---|---|---|
5htR2-forA | TCGCGCACTTCATCTCG | Cloning initial partial cDNA (1969-1985) |
5htR2-revA | TTCTTGAATGCTTGTCGAAAC | Cloning initial partial cDNA (2231-2211) |
5htR2-for1 | GCAGCTGGCAACATCC | Further cloning partial cDNA (250-265) |
5htR2-for2 | AGTTTACTGTTTGGCGTGG | Further cloning partial cDNA (417-435) |
5htR2-for3 | CAAATACTATAGTAACATGGGATTCC | Further cloning partial cDNA (1688-1713) |
5htR2-rev1 | CGATATCGACACAATAAGACTTTC | Further cloning partial cDNA (2252-2229) |
5htR2-rev2 | CTAAGTGGAAGACTCATAGCTATCG | Further cloning partial cDNA (614-590) |
5htR2-rev3 | GCATGACGAGTATGGCGAC | Further cloning partial cDNA (370-352) |
5htR2_3raceF1 | GAAGGAAAGCCAATGAAGAAGATAGG | 3′ RACE PCR (1211-1236) |
5htR2_3raceF2 | GTATTCGATTTTGTCACATGGTTAGG | 3′ RACE PCR (2134-2159) |
5htR2_3raceF3 | TAAAGTGTTTCGACAAGCATTCAAG | 3′ RACE PCR (2205-2229) |
5htR2_3raceR | TCTTGAATGCTTGTCGAAACAC | 3′ RACE PCR positive control (2230-2209) |
5htR2_5raceR1 | TGCACCAAACTGTTGTAAAGC | 5′ RACE PCR (1047-1027) |
5htR2_5raceR2 | CGCTCGCCCAACC | 5′ RACE PCR (835-823) |
5htR2_5raceR3 | GCATGACGAGTATGGCGAC | 5′ RACE PCR (370-352) |
5htR2_5raceF | GCAGCTGGCAACATCC | 5′ RACE PCR positive control (250-265) |
5htR2-ORF-F1 | GGCCAAGAAGAAGAGGATGTG | Amplification of complete open reading frame (153-173) |
5htR2-ORF-R1 | GTTATTGTTACATCTGCCTACGTTC | Amplification of complete open reading frame (2297-2273) |
5htR2-ORF-kozak | GCCACCATGTGCAGTGATACAACAGG | Addition of Kozak translation initiation sequence into expression construct (169-188) |
5htR2-ORF-R2 | CTACGTTCTAGGTGTCCAGCG | Expression construct amplification (2280-2260) |
5htR2-qPCR-F | GAACAACGGCAGAACTTGG | Sense primer for qPCR located on exon 4 |
5htR2-qPCR-R | AATGCCCTCCTCTTTGTATGG | Anti-sense primer for qPCR located on exon 5 |
Initial oligonucleotide sequences designed based on high-scoring hits from tBLASTn search of preliminary R. prolixus genome database using D. melanogaster serotonin receptor type-2 sequences as query. Oligonucleotide sequences used in screening of cDNA plasmid library and RACE PCR based on partial initial sequence obtained. Final primer sets for verification of complete open-reading frame (ORF) and mammalian expression contruct based on complete cDNA sequenced de novo and sequence comparisons with the preliminary R. prolixus genome assembly.