Table 1.
Primers used in the present study
| Primer codes | Sequences (5′-3′) | Target gene | References |
|---|---|---|---|
| XCCOX3F | AGYACDGTDGGDTTRCATTT | cox31 | Present study |
| XCCOX3R | CANAYATAATCMACARAATGNCA | cox31 | Present study |
| nxccobF | ATGTCWTWTTGRGCKGCBACNGT | cytb1 | Present study |
| nxccobR | GADVCTCNGGRTGRCAVGCHCC | cytb1 | Present study |
| nxcND4F | GAKTCBCCDTATTCDGARCG | nad41 | Present study |
| nxcND4R | ACHCCNGCHGANANMCCRTGMCC | nad41 | Present study |
| TXCCOX1F | GGHTGAACHRTWTAYCCHCC | cox11 | Present study |
| TXCCOX1R | TGRTGRGCYCAWACDAYAMAHCC | cox11 | Present study |
| XC12SF | AAWAAYGAGAGYGACGGGCG | rrnS1 | Present study |
| XC12SR | TARACTAGGATTAGATACCC | rrnS1 | Present study |
| NxcND5F | TGKTTGCBTCNCGNTTBGGNGATG | nad51 | Present study |
| NxcND5R | TAACACTTRCANAHMCCRTGHGT | nad51 | Present study |
| 3CF1 | TGCATGTAGTGATAGGTTTGG | cox3- cytb2 | Present study |
| 3CR1 | AACTAACGTAACATTTGTCAC | cox3- cytb2 | Present study |
| 3CF2 | TTTGTTTTGTGGTTGCCTTC | cytb-nad42 | Present study |
| 3CR2 | AACGTAAATTAAACCTCCCCC | cytb-nad42 | Present study |
| 3CF3 | TGGCGTTTTTGAGTTTGTCTC | nad4-cox12 | Present study |
| 3CR3 | TCAACGAACTCAATATACTTG | nad4-cox12 | Present study |
| 3CF4 | TGGTTTCGGGGCTGTGAGAC | cox1-rrnS2 | Present study |
| 3CR4 | ACCAAGCAAAGAAAATTCTACC | cox1-rrnS2 | Present study |
| 3CF5 | TGTTAAAAGGCTTTGGTGTG | rrnS-nad52 | Present study |
| 3CR5-1 | ACCAACCAAACCTACACATC | rrnS-nad52 | Present study |
| 3CF6-1 | TTACGTTAGTTGGGTTGTTG | nad5-cox32 | Present study |
| 3CR6 | TTACATCTTTATAAAACACTTTC | nad5-cox32 | Present study |
1 short regions amplified by PCR from cox3 (139 bp), cytb (613 bp), nad4 (554 bp), cox1 (497 bp), rrnS (500 bp) and nad5(458 bp). 2 large fragments that were amplified by long-range PCR from cox3-cytb (724 bp), cytb-nad4 (1008 bp), nad4-cox1 (4675 bp), cox1-rrnS (2198 bp), rrnS-nad5 (1981 bp) and nad5-cox3 (1718 bp)