Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers to confirm location of genes in Rub 256e region
| Gene in Rub256e region | Primer sequence |
|---|---|
| Ara4 1 256e | Ggcaagtttacccagctgaa |
| catatgagtgcgcagatacag | |
| Ara4 2 256e | Cattccctgcgttgaaatct |
| Ttctgagtcgtctggtgtgc | |
| Nudix256e | Gaaggttttcggtaccacca |
| tcctgcttctggatgtcaaa | |
| Signalo256e | Tgcatcctggatatggattt |
| ccaagttgcccatgagaataa |
