Table 2.
Characteristics of selected miRNAs using MiRdup* and MIRcheck validated by northern blot
| ID | MiRNAs | A | B | C | D | Associated conditions | Relevant targets (with uniref ID) | Training dataset |
|---|---|---|---|---|---|---|---|---|
| Predicted MiRNAs in common with MiRdup* and MIRcheck | ||||||||
| apMir_20602 | GUCAUCUAUAUUGGAACGGAG | 1 | 1 | 1 | 5 | Salt, floral transition and flowering | Glutathione peroxidase (Q9SME6), putative phosphatase phospho1 (M8CZ66) | BM |
| apMir_19980 | AUAGCAUCAUCCAUCCUACCA | 3 | 1 | 3 | 6 | Al, floral transition and flowering | Putative membrane-associated protein (gi|22548307|gb|BU100508.1|BU100508) | BPM |
| apMir_14769 | GUUGUCAUAUAUGUAUUGA | 2 | 1 | 2 | 6 | Cold, Al and salt | Putative RSH disease resistance-related protein (Q8H5X7), T-complex protein 1 subunit alpha (I3RZC6) | M |
| apMir_21052 | UGAGAUGAGAUUACCCAAUAC | 3 | 2 | 4 | 7 | Cold, floral transition and flowering | NA | P |
| Predicted MiRNAs specific to MiRdup* | ||||||||
| apMir_16808 | CAUCGAUCAUCCAUCACCC | 2 | 5 | 6 | 7 | Not differentially expressed | Dehydrin, (CD909074, TA50415_4565), Phosphorylase (Q84P16) | B |
| apMir_86202 | AGGGUCGGCCAGCGGUGCGGCCCGU | 4 | 2, 4 | 8 | 6 | Cold, floral transition and Al | NA | BM |
| apMir_54471 | UCAGUCAUAAUCCGGCAC | 3 | 1 | 3 | 7 | Salt, Al and floral transition | NA | MP |
| Conserved miRNAs predicted in common by MiRdup* and MIRcheck | ||||||||
| apMir_22246 (tae-miR160) | UGCCUGGCUCCCUGUAUGCCA | 3 | 1 | 3 | 9 | Cold, salt, Al, floral transition and flowering | Auxin response factor (M8BC98), Auxin responsive protein (R7WEP7) | BPM |
| apMir_20968 (miR395-21) | UGAAGUGUUUGGGGGAACUCU | 2 | 1 | 2 | 8 | Cold, salt, Al, flowering | Bifunctional 3′-phosphoadenosine 5′-phosphosulfate synthase (M7ZFX2), ATP sulfurylase (M9T1P9) | BMP |
The selection was based on several characteristics of the miRNA secondary structure in the duplex including, the number of bulges in the duplex (A), number of the successive unpaired bases in each bulge in the duplex (B), total number of the unpaired bases within the duplex (C), nucleotide number in the loop (D). Training datasets (B: all miRBase species; P: all plants; M: monocot only). The reverse complement sequences of miRNAs used as probes for northern blot validation are presented in Additional file 2: Table S11.