Table 3.
Sequences and efficiencies of primers used in current study.
| Symbol | Gene name | Accession number | Primer sequence 5′→3′ (forward/reverse) | Amp. size | E [%] tissue | E [%] blood | E [%] cells |
|---|---|---|---|---|---|---|---|
| GAPDH a | Glyceraldehyde-3-phosphate dehydrogenase | NM_002046.4 | F: gtctcctctgacttcaacagcg R: accaccctgttgctgtagccaa |
131 bp | 102.1 | — | — |
|
| |||||||
| IPO8 | Importin 8; nuclear protein import | NM_006390.3 | F: tggtatggtggaagtgtaagaagtg R: ttggttgagatagttgaatgcttgc |
230 bp | — | — | 100.9 |
|
| |||||||
| PPIA a | Peptidylprolyl isomerase A | NM_021130.3 | F: ggcaaatgctggacccaacaca R: tgctggtcttgccattcctgga |
161 bp | 99.7 | — | 104.6 |
|
| |||||||
| SDHA | Succinate dehydrogenase subunit A | NM_004168.2 | F: agaggcacggaaggagtcac R: caccacatcttgtctcatcagtagg |
267 bp | — | 94.8 | 95.9 |
|
| |||||||
| TBP | TATA-box-binding protein | NM_003194.4 | F: tataatcccaagcggtttgctg R: ctggctcataactactaaattgttg |
283 bp | — | 109.7 | 102.2 |
|
| |||||||
| YWHAZ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide; signal transduction | NM_003406.3 | F: tcacaacaagcataccaagaagc R: gtatccgatgtccacaatgtcaag |
263 bp | — | — | 97.4 |
|
| |||||||
| NAMPT | Nicotinamide phosphoribosyltransferase | NM_005746.2 | F: cacaggcaccactaataatcagac R: ctccaccagaaccgaaggc |
243 bp | 104 | 108.8 | 94.8 |
|
| |||||||
| IL1β a | Interleukin 1β | NM_000576.2 | F: ccacagaccttccaggagaatg R: gtgcagttcagtgatcgtacagg |
131 bp | 94.7 | 100.1 | — |
|
| |||||||
| IL8 | Interleukin 8 | NM_000584.3 | F: caacacagaaattattgtaaagc R: aagtgttgaagtagatttgc |
191 bp | 96.7 | 99.8 | — |
|
| |||||||
| CCL2 | Monocyte chemotactic protein- (MCP-) 1 | NM_002982.3 | F: tctgtgcctgctgctcatag R: acttgctgctggtgattcttc |
155 bp | 99.7 | — | — |
|
| |||||||
| CCL4 a | Macrophage inflammatory protein- (MIP-) 1β | NM_002984.2 | F: ggtcatacacgtactcctggac R: gcttcctcgcaactttgtggtag |
140 bp | 92.1 | 103.5 | — |
|
| |||||||
| FGF2 | Basic fibroblast growth factor | NM_002006.4 | F: tctatcaaaggagtgtgtgctaacc R: tgcccagttcgtttcagtgc |
179 bp | 100.7 | — | — |
|
| |||||||
| HIF1α | Hypoxia-inducible factor 1α | NM_001530.3 | F: ctgccaccactgatgaatta R: gtatgtgggtaggagatgga |
90 bp | 104.7 | — | — |
|
| |||||||
| PCNA a | Proliferating cell nuclear antigen | NM_002592.2 | F: caagtaatgtcgataaagaggagg R: gtgtcaccgttgaagagagtgg |
126 bp | 100.8 | — | — |
|
| |||||||
| TNFα a | Tumor necrosis factor α | NM_000594.3 | F: ctcttctgcctgctgcactttg R: atgggctacaggcttgtcactc |
135 bp | 98.2 | 100.1 | — |
|
| |||||||
| VEGF-A a | Vascular endothelial growth factor A | NM_001025366.2 | F: ttgccttgctgctctacctcca R: gatggcagtagctgcgctgata |
126 bp | 96.1 | 94.5 | — |
Amp., amplicon; E, efficiency; aprimer sequences were as proposed by Origene (http://www.origene.com/). Remaining primers were designed using Beacon Designer Probe/Primer Design Software (BioRad), validated in silico by Blast analysis, and their specificity was tested by means of melting curve analysis and an electrophoresis in a high-resolution agarose (SeaKem LE agarose, Lonza, Switzerland) in TBE with SYBR Green (Lonza) detection. Efficiencies were calculated on pooled cDNA, separately for expression analysis in whole blood, colorectal tissue, and cell culture experiments.
Forward and reverse primer sequences are denoted by “F” and “R,” respectively.