Abstract
Background
Polysaccharopeptide (PSP), isolated from Coriolus versicolor COV-1 strain, is a protein-bound polysaccharide widely used as immunoadjuvant for cancer immunotherapy. Although the immunomodulatory activity of PSP has been well established, the precise molecule mechanisms of its biological activity have yet to be fully elucidated.
Methods
In the present study, we first investigated the immunomodulatory activity of PSP in peritoneal macrophages from C57BL/10J (TLR4+/+) and C57BL/10ScCr (TLR4-/-) mice carrying a defective toll-like receptor-4 (TLR4) gene and then evaluated PSP for its effect on tumor inhibition rates and the immune organ index in above two different strains of mice. In addition, PSP were also evaluated for its activation of TLR4, TLR4-downstream molecules (TRAF6, NF-κB and AP-1) in spleens of tumor-bearing C57BL/10J (TLR4+/+) and C57BL/10ScCr (TLR4-/-) mice.
Results
The results showed that PSP had adjuvant activities in stimulating expressions of cytokines as well as TLR4, TRAF6, phosphorylation of NF-κB p65 transcription factors and phosphorylation of c-Jun (a component of the transcription factor AP-1) in peritoneal macrophages from C57BL/10J (TLR4+/+) mice but not from C57BL/10ScCr (TLR4-/-) mice. In vivo PSP as well as Adriamycin (ADM) decreased the mean weights of tumors compared with normal saline and PSP increased thymus index and spleen index relative to ADM in tumor-bearing C57BL/10J (TLR4+/+) mice but not in C57BL/10ScCr (TLR4-/-) mice.
Conclusions
We demonstrated that PSP activates peritoneal macrophages in vitro via TLR4 signaling pathway and PSP functions its immunoregulatory effect in vivo also via TLR4 signaling pathway. These data strongly suggest TLR4 signaling pathway is involved in PSP-mediated immunomodulatory activities.
Keywords: Polysaccharopeptide, TLR4, TLR4 signaling pathway, Immunomodulatory
Background
Historically, Mushrooms have been considered as important source of materials in traditional Chinese medicine. Polysaccharide extracts from mushrooms display immunomodulatory and anti-tumor activities in vivo and in vitro [1–3]. Coriolus versicolor (better known as Yunzhi in China), a medicinal fungus of the Basidiomycetes family, has been used as a “magic herb” for promoting good health and longevity. Its medicinal value was recorded in the Compendium of Materia Medica and Shen Non Compendium Medica thousands of years ago in China [4–6]. Polysaccharopeptide (PSP) is a protein-bound polysaccharide extracted from the deep-layer cultivated mycelia of C. versicolor COV-1 strain [7]. PSP, which has an approximate molecular weight of 100KDa and is highly water-soluble, appears to be safe during pregnancy. It did not affect ovarian steroidogenesis, ovulation and midterm gestation in mice [4, 8, 9]. Numerous scientific investigations have demonstrated that PSP has anti-tumor, anti-inflammatory, immunoregulatory and antiviral effects in vivo and in vitro [5, 10–12]. PSP was also found to restore a depressed immunological responsiveness in patients suffering from cancer or in chemotherapy [13, 14]. However, the underlying molecular mechanisms involved in those functions have not been clearly elucidated.
Recent researches indicated that the immunoregulatory effects of polysaccharides are related to the Toll-like receptors (TLR) signaling pathway [15, 16], and Toll-like receptors 4 (TLR4) plays a central role in the enhancement of the innate immune response and the production of cytokine induced by polysaccharides [17–20]. A family of TLRs plays an important role in the recognition of molecular structures that are shared by many pathogens in the host defense system [21, 22]. TLR4 is the first mammalian homologue of the Drosophila Toll protein [23] and recognizes lipopolysaccharide (LPS) from Gram-negative bacteria, which causes septic shock [24, 25]. Further study indicates that TLR4 is the immune receptor of both Ganoderma lucidum polysaccharides (GLPS) and polysaccharides from Astragalus membranaceus [26, 27]. In addition, our previous studies have reported that PSP has an immunoregulatory effect through the TLR4 signaling pathway in human peripheral blood mononuclear cells (PBMCs) [28].
To further elucidate the molecular mechanisms for the immunoregulatory function of PSP, based on previous evidences, we focused on investigating the role of TLR4 and TLR4 signaling pathway in the PSP-mediated immunomodulation activities. In this paper, C57BL/10ScCr mice (TLR4-defect mice lacking functional TLR4), C57BL/10 J mice (wild-type mice with functional TLR4) and the peritoneal macrophages isolated from these two strains were used to demonstrated the immunomodulation mechanism of PSP mediated by TLR4 signaling pathway both in vitro and in vivo.
Results
PSP-induced activation of macrophages through TLR4
The activation of macrophages facilitates the production of many immunomodulatory substances including cytokines. In order to verify if TLR4 was required for PSP activation of macrophages, peritoneal macrophages from ScCr (TLR4−/−) and B10 (TLR4+/+) mice were incubated with PSP (25 μg/ml) or LPS (100 ng/ml) as a positive control for 24 h and then assayed for TNF-α and IL-6 concentration in their culture supernatant. As shown in Fig. 1, both LPS and PSP induced TNF-α secretion by peritoneal macrophages from wild-type control B10 mice but did not induce TNF-α secretion in ScCr mice lacking functional TLR4 (Fig. 1a). Similarly, LPS and PSP failed to induce IL-6 secretion in ScCr mice (Fig. 1b). These results suggest that TLR4 is involved in PSP activation of murine macrophages.
Effect of PSP on activation of TLR4 signaling pathway in peritoneal macrophages from B10 (TLR4+/+) and ScCr (TLR4−/−) mice
TLR4 activates intracellular signaling pathways that lead to the induction of cytokines, such as TNF-α and IL-6 [29, 30]. To elucidate TLR4 signaling pathway involved in PSP-mediated macrophage activation, we examined activation of TLR4, TLR4-downstream molecules (TRAF6, NF-κB and AP-1) in TLR4+/+ and TLR4−/− peritoneal macrophages at protein level. After incubation with PSP (25 μg/ml) or LPS (100 ng/ml) for 12 h in 5 % CO2 at 37 °C, western blot was performed. As shown in Fig. 2, the protein levels of TLR4 and TRAF6 were upregulated in PSP and LPS group compared with control group in peritoneal macrophages of B10 (TLR4+/+) mice (all p < 0.05). The phosphorylation levels of transcription factors NF-κB (p65 subunit) and AP-1 (P-c-Jun) were likewise significantly higher in PSP and LPS group than control group in peritoneal macrophages of B10 (TLR4+/+) mice (all p < 0.05). No significant differences in those protein expressions were found between groups in ScCr (TLR4−/−) mice, suggesting that the activation was dependent on TLR4 signaling pathway.
General state of tumor-bearing mice
After administration, there was no abnormality seen daily in the autonomic activities, behavior, ingestion, pelage, feces, and urine of mice in each group. Also, there were no abnormal secretion in the eye, ear, nose, and mouth.
Effect of PSP on tumor inhibition rates and the immune organ index in B10 (TLR4+/+) and ScCr (TLR4−/−) tumor-bearing mice
In vivo immunoregulatory and anti-tumor activities of PSP were examined in B10 (TLR4+/+) or ScCr (TLR4−/−) mice inoculated with Ehrlich’s ascites carcinoma (EAC) cells. Twenty five days after inoculation, the mean weights of tumors in B10 (TLR4+/+) tumor-bearing mice that received PSP and ADM treatment were significantly decreased compared with those in the saline group (all p < 0.05). The inhibition rates of ADM group and PSP group were 40.67 % and 29.64 %. In ScCr (TLR4−/−) mice, the mean weights of tumors in the ADM group were decreased significantly compared with those in the saline group (p < 0.05),however, there were no significant change trends between PSP group and saline group (Fig. 3a). Furthermore, in B10 (TLR4+/+) tumor-bearing mice, the thymus index in the ADM group decreased significantly, as compared with that in the saline group (p < 0.05). Both the thymus index and spleen index in the PSP group increased significantly relative to that in the ADM group (all p < 0.05). However, there were no significant differences of the thymus index and spleen index among groups in ScCr (TLR4−/−) mice (Fig. 3b and c).
TLR4 expression and signaling in spleens of B10 (TLR4+/+) and ScCr (TLR4−/−) mice exposed to PSP
The signaling pathway mediated by TLR4 has been implicated in the response to PSP in vitro. To clarify whether TLR4 signaling pathway is involved in PSP-mediated immunomodulation in vivo, we studied the expression at mRNA and protein level of TLR4, TRAF6, NF-κB and AP-1 in the spleen of B10 (TLR4+/+) and ScCr (TLR4−/−) mice. Twenty five days after administration, TLR4, TRAF6, NF-κB and AP-1 in PSP and LPS group (positive control) were significantly increased at mRNA and protein level relative to those of the saline group in the spleen of B10 (TLR4+/+) tumor-bearing mice (all p < 0.05). As expected, there were no significant differences in the expressions of TLR4, TRAF6, NF-κB and AP-1 among groups in ScCr (TLR4−/−) mice (Fig. 4).
Discussion
PSP is well-known for its immunoregulatory effect, attaining widespread usage as therapeutic adjuvant for cancer immunotherapy in China and Japan [4]. Previous studies have indicated that PSP could significantly increase the percentage of CD4+ T lymphocytes, the ratio of CD4+/CD8+ and the quantity and percentage of the B lymphocytes and finally enhanced the immune system of cancer patients [14, 31]. However, studies concerning the underlying mechanisms involved in PSP-mediated immunomodulation effects are very limited. Our previous study demonstrated that PSP has an immunoregulatory effect through the TLR4 signaling pathway in PBMCs from breast cancer patients [28].
The role of TLR4 in Gram-negative bacterial LPS-mediated signaling has been studied extensively [32, 33]. Our current results indicated that both PSP and LPS transduces part of signalings via the TLR4, but the biological outcomes are quite different. Interestingly, PSP has been used to promote health in many Asian countries, but concentrated LPS of contaminated bacteria causes high mortality in vitro or in vivo [19]. However, the molecular mechanisms for PSP or LPS in the differential immunity outcomes are not clear.
In our study, to delineate the signaling pathway involved in PSP-mediated immunomodulation in vitro, peritoneal macrophages from ScCr (TLR4−/−) and B10 (TLR4+/+) mice were used. Macrophages, which provide an important bridge between innate and adaptive immunity, play critical roles in host defense, including phagocytosis of pathogens and apoptotic cells, production of cytokines, and proteolytic processing and presentation of foreign antigens [34, 35]. The activation of macrophages facilitates the production of many immunomodulatory substances including cytokines, such as TNF-α, IL-6 and IFN-γ, which are known to play an important role in suppressing tumor cells. Indeed, a variety of plant polysaccharides have been shown to possess immunomodulatory activity through their ability to modulate macrophage function [36]. When incubated with PSP (25 μg/ml) and LPS (100 ng/ml) for 24 h, peritoneal macrophages from B10 (TLR4+/+) mice increased their production of TNF-α and IL-6. However, production of TNF-α and IL-6 in PSP and LPS stimulated peritoneal macrophages from ScCr (TLR4−/−) was significantly reduced (Fig. 1). Moreover, PSP and LPS upregulated the expressions of TLR4 and TLR4-downstream molecules (TRAF6, Phospho-NF-κB p65 and Phospho-c-Jun) in B10 (TLR4+/+) peritoneal macrophages but not in ScCr (TLR4−/−) peritoneal macrophages (Fig. 2). As TLR4 recognizes LPS from most Gram-negative species, LPS was used as the prototypical TLR4 agonist to provide a positive reference. These results suggest that TLR4 signaling pathway is involved in PSP-induced activation of macrophages in vitro.
To verify whether TLR4 signaling pathway is involved in PSP-mediated immunomodulation in vivo, we found PSP and ADM treatment significantly decreased the mean weights of tumors than saline treatment in B10 (TLR4+/+) tumor-bearing mice (Fig. 3a). At the same time, PSP administration significantly increased the thymus index and spleen index relative to ADM administration in B10 (TLR4+/+) mice (Fig. 3b and c). However, these significant changes were not observed in ScCr (TLR4−/−) tumor-bearing mice (Fig. 3). These results indicate that PSP could inhibit tumor growth and alleviate the decrease of thymus and spleen induced by ADM via TLR4 signaling pathway.
In vivo, the activation of TLR4 and TLR4-downstream molecules (TRAF6, NF-κB and AP-1) in spleens of B10 (TLR4+/+) and ScCr (TLR4−/−) tumor-bearing mice were measured by Q-PCR and Western blot. In Q-PCR experiments, Vandesompele method, which is more advanced than the Pfaffl method, was applied to analyze these data. The Vandesompele method normalizes not only with the adjusted PCR efficiency but also with multiple genes. β-actin and GAPDH were used as reference genes to assay the relative mRNA expression levels. LPS was used as positive reference like in vitro study. From the results, we found that the mRNA and protein levels of TLR4, TRAF6, NF-κB and AP-1 were significantly upregulated by PSP as well as LPS in spleens of B10 (TLR4+/+) tumor-bearing mice (Fig. 4). At the same time, these significantly differences were not observed in ScCr (TLR4−/−) mice (Fig. 4).
Conclusions
In summary, our present study demonstrated that PSP activates peritoneal macrophages in vitro via TLR4 signaling pathway and PSP functions its immunoregulatory effect in vivo also via TLR4 signaling pathway. These data strongly suggest TLR4 signaling pathway is involved in PSP-mediated immunomodulatory activities.
Methods
Animals
Female 4–6 weeks old C57BL/10ScCr (ScCr, TLR4−/−) and C57BL/10 J (B10, TLR4+/+) mice (Permit number: scxk 2010–0001), weighing 16-20 g, were purchased from Model Animal Research Center of Nanjing University (Nanjing, China). The C57BL/10ScCr murine strain has a homozygous deletion of 74,723 bp at the tlr4 locus, removing all three exons, which abolishes the response to LPS in these mice [24]. The C57BL/10 J murine strain was used as the wild-type control group. Both strains will be described as ScCr and B10 throughout the article. All experiments were followed the protocols approved by the Animal Care and Use Committee of the Second Affiliated Hospital of Chongqing Medical University.
Preparation of PSP solution
PSP, isolated from Coriolus versisicolor COV-1, was obtained from Jiangsu shenhua pharmaceutical Co., LTD (Jiangsu, China). It was characterized as previously described [28]. Gram-negative bacterial endotoxin level of the PSP was measured by using chromogenic end-point tachypleus amebocyte lysate (CE TAL) assay kit (Chinese Horseshoe Crab Reagent Manufactory Co., Ltd., Xiamen, China) according to the manufacturer’s instruction in our previous study, the results showed that very low endotoxin level (below 0.34 EU/ml) was found in PSP at 100 μg/ml, indicating that endotoxin contamination in PSP was negligible [28]. In our study, PSP was dissolved in physiological saline for in vivo experiments or in plain RPMI-1640 medium (HyClone, Thermo scientific, USA), sterilized by passing through a 0.22-μm filter (Millipore, USA) and stored at −20 °C for future use.
Preparation of tumor cells
Ehrlich’s ascites carcinoma (EAC) cells were purchased from Nanjing KeyGEN biotech Co., Ltd. (Nanjing, China), cultured and passaged in abdominal cavity of mice.
Isolation of mouse peritoneal macrophages
Peritoneal macrophages were obtained from ScCr and B10 mice by intraperitoneal injection of sterile thiolglycollate medium. Four days after injection peritoneal macrophages were harvested from mice.
Modeling of the tumor-bearing mice
Murine EAC cells were cultured in the abdominal cavity of mice for 7–8 days. They were taken out from the ascites, diluted to the concentration of 1 × 107cells ml−1 with sterilized physiological saline. Then 0.1 mL EAC cell suspension was inoculated subcutaneously to the right armpit of each mouse. Generally, the solid tumor could be palpated after 7–10 days with an achievement ratio of nearly 100 %. After inoculation, each mouse was weighed immediately. After 24 h, intraperitoneal injection and intragastric administration were carried out simultaneously.
Experimental design
For in vitro experiments, the cultured peritoneal macrophages from ScCr and B10 mice were treated with PSP (25 μg/ml) or LPS (100 ng/ml) from Escherichia coli O55:B5 (L6529, sigma, USA) for an indicated time period. The supernatants were harvested for detection of cytokine levels and the cell lysates were collected for Western blotting analysis.
For in vivo experiments, ScCr and B10 mice were used to establish the EAC tumor-bearing model. ScCr and B10 tumor-bearing mice were randomly assigned into eight groups. Mice in ScCr saline group and B10 saline group were orally administered with saline for 25 days. Mice in ScCr Adriamycinc (ADM) group and B10 ADM group were treated with 5.33 mg/kg/d ADM (Actavis Italy S.p.A, ITA) through peritoneal injection for the first 3 days, followed by 22 days of saline administration. Mice in ScCr PSP group and B10 PSP group were given PSP (500 mg/kg/d) by oral route for 25 days. Mice in ScCr LPS group and B10 LPS group were orally administered with saline for 25 days and then intraperitoneally injected with LPS (5 mg/kg) 4 h before sacrificed [37]. Twenty-five days after administration, mice were killed by cervical dislocation. The whole body, tumor, spleen and thymus were weighed immediately to calculate the tumor inhibition rate and the immune organ index. The spleen tissue samples were extracted, immediately frozen in liquid nitrogen and then stored at −80 °C for Q-PCR and Western blot analyses.
Cytokine analysis
Mouse peritoneal macrophages from ScCr and B10 mice were plated in 24-well plates at a density of 2.5 × 105 cells/well and treated with or without PSP (25 μg/ml) or LPS (100 ng/ml) as a positive control. Cells were incubated for 24 h at 37 °C in 5 % CO2. Culture supernatants were then collected for determining cytokine concentrations using Mouse TNF-α and IL-6 ELISA kits (4abio, China) according to the manufacturer’s instructions.
Tumor inhibition rate and the immune organ index
The tumor inhibition rate and the immune organ index were calculated as described previously [13]. Briefly, the inhibition rates of growth of EAC solid tumor were calculated according to the formula: inhibition rate (%) = (1- mean weight of tumor in administration groups/ mean weight of tumor in the saline group) × 100 %. The organ indexes of spleen and thymus were calculated according to the formula: organ index (%) = mean weight of organ / body weight × 100 %.
Quantitative real-time PCR assay
Total RNA in spleen homogenates was extracted via RNAiso Plus (Takara, Japan) and reversed transcribed into cDNA with PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Japan) according to the manufacturer’s instructions. Q-PCR was performed on Bio-Rad CFX-96 (Bio-Rad, Foster City, CA, USA), using SYBR® Premix Ex TaqTM II (Takara, Japan). GAPDH and β-actin served as endogenous normalization control (reference genes). The relative expression of mRNA was calculated by Vandesompele Method. The sequences and related information of the Q-PCR primers are shown in Table 1. Amplification began with initial denaturation for 30 s at 95 °C followed by 40 cycles of denaturation at 95 °C for 5 s, annealing and extension at 58 °C for 30 s and then the plate was read. To analyze the specificity of the products, a melt curve procedure was added on Bio-Rad CFX96. Triplicate reactions were run per sample.
Table 1.
Gene symbol | Genbank accession no. | Primer sequence (5’ → 3’) | Product size (bp) | Annealing temperature | E (%) | R2 |
---|---|---|---|---|---|---|
TLR4 | NM_021297.2 | F ctgggtgagaaatgagctggtaa | 122 | 58 °C | 96.5 | 0.999 |
R agccttcctggatgatgttgg | ||||||
TRAF6 | NM_009424 | F catcttcagttaccgacagctcag | 131 | 58 °C | 95.2 | 0.999 |
R tggtcgagaattgtaaggcgtat | ||||||
NF-κB | NM_008689.2 | F ccaaagaaggacacgacagaatc | 127 | 58 °C | 95.5 | 0.999 |
R ggcaggctattgctcatcaca | ||||||
AP-1 | NM_010591.2 | F gccctggctgaactgcatag | 180 | 58 °C | 91.4 | 0.998 |
R gaagttgctgaggttggcgta | ||||||
GAPDH | NM_008084.2 | F gacatcaagaaggtggtgaagc | 117 | 58 °C | 96.2 | 0.999 |
R gaaggtggaagagtgggagtt | ||||||
β-Actin | NM_007393.3 | F agattactgctctggctcctagc | 147 | 58 °C | 93.6 | 0.998 |
R actcatcgtactcctgcttgct |
F Forward primer, R Reverse primer, E Amplification efficiency, R 2 Correlation coefficient
Western blot analysis
Mouse peritoneal macrophages and spleen tissues were prepared for Western blot analysis. Protein concentrations were measured by BCA assay (Beyotime, Jiangsu, China), and were separated SDS-PAGE gels and transferred onto PVDF membranes (Millipore, USA). The membranes were blocked and incubated sequentially overnight at 4 °C with antibodies and β-actin.
Statistical analysis
All values were expressed as means ± standard deviation (SD). Statistical differences between the experimental groups were examined by ANOVA followed by and analyzed by post hoc Student’s Newman-Keuls test with SPSS software (SPSS 18.0). Differences with P values of <0.05 were considered significant.
Acknowledgments
This study was supported by the funds of National Natural Science Foundation of China (NO. 81274144 and 81473388), and was carried out at the Experimental Animal Center of Chongqing Medical University and the Central Laboratory in the Second Affiliated Hospital of Chongqing Medical University.
Abbreviations
- PSP
Polysaccharopeptide
- TLR4
Toll-like receptors 4
- PBMCs
Peripheral blood mononuclear cells
- EAC
Ehrlich’sascites carcinoma
- ADM
Adriamycin
- GLPS
Ganoderma lucidum polysaccharides
- IRF5
Interferon regulatory factor 5
- NF-κB
Nuclear factor-κB
- TRAF6
TNF receptor-associated factor 6
- ERK
Extracellular signal-regulated kinase
- P38
p38 MAP kinase
- JNK
c-Jun N-terminal kinase
- AP-1
Activator protein-1
- LRR
Leucine rich repeats
- PAMPs
Pathogen-associated molecular patterns
- TIR
Toll/IL-1 receptor
- LPS
Lipopolysaccharide
- MyD88
Myeloid differentiation factor 88
- TRIF
TIR domain-containing adaptor inducing IFN-β
- MAPK
Mitogen-activated protein kinase
Footnotes
Zhixue Wang and Bing Dong contributed equally to this work.
Competing interests
All authors have read and approved the manuscript for submission. Neither the manuscript nor its portions have been published previously or are under consideration for publication elsewhere. The authors declare to have no competing interests.
Authors’ contributions
ZW, BD, ZF, SY carried out experiments, analyzed data and performed the statistical analysis. ZW, BD and YB conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.
Contributor Information
Zhixue Wang, Email: cqwangzhixue@163.com.
Bing Dong, Email: wan7908116@163.com.
Zifang Feng, Email: fengzifang4744@126.com.
Shuang Yu, Email: yushuang_6251161@163.com.
Yixi Bao, Phone: +86 23 6369 3729, Email: yixibao@163.com.
References
- 1.Reshetnikov SV, Wasser SP, Tan KK. Higher Basidiomycota as a source of antitumor and immunostimulating polysaccharides. Int J Med Mushrooms. 2001;3:361–394. [Google Scholar]
- 2.Tzianabos AO. Polysaccharide immunomodulators as theurapeutic agents: structural aspects and biological function. Clin Microbiol Rev. 2000;13:523–533. doi: 10.1128/CMR.13.4.523-533.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ooi VEC, Liu F. A review of pharmacological activities of mushroom polysaccharides. Int J Med Mushrooms. 1999;1:195–206. doi: 10.1615/IntJMedMushrooms.v1.i3.10. [DOI] [Google Scholar]
- 4.Ng TB. A review of research on the protein-bound polysaccharide (polysaccharopeptide, PSP) from the mushroom Coriolus versicolor (Basidiomycetes: Polyporaceae) Genl Pharmacol-Vasc S. 1998;30:1–4. doi: 10.1016/S0306-3623(97)00076-1. [DOI] [PubMed] [Google Scholar]
- 5.Kidd PM. The use of mushroom glucans and proteoglycans in cancer treatment. Altern Med Rev. 2000;5:4–27. [PubMed] [Google Scholar]
- 6.Wasser SP, Weis AL. Therapeutic effects of substances occurring in higher Basidiomycetes mushrooms: a modern perspective. Crit Rev in Immunol. 1999;19:65–96. [PubMed] [Google Scholar]
- 7.Yang MMP, Chen Z, Kwok JSL. The anti-tumor effect of a small polypeptide from Coriolus vericolor (SPCV) Am J Chin Med. 1992;20:221–232. doi: 10.1142/S0192415X92000230. [DOI] [PubMed] [Google Scholar]
- 8.Cui J, Chisti Y. Polysaccharopeptides of Coriolus versicolor: physiological activity, uses, and production. Biotechnol Adv. 2003;21:109–122. doi: 10.1016/S0734-9750(03)00002-8. [DOI] [PubMed] [Google Scholar]
- 9.Ng TB, Chan WY. Polysaccharopeptide from the mushroom Coriolus versicolor possesses analgesic activity but does not produce adverse effects on female reproductive or embryonic development in mice. Genl Pharmacol-Vasc S. 1997;29:269–273. doi: 10.1016/S0306-3623(96)00412-0. [DOI] [PubMed] [Google Scholar]
- 10.Wang HX, Ng TB. Examination of lectins, polysaccharide, alkaloid, coumarin and trypin inhibitors for inhibitory activity against human immunodeficiency virus reverse transcriptase and glycohydrolases. Planta Med. 2001;67:669–672. doi: 10.1055/s-2001-17359. [DOI] [PubMed] [Google Scholar]
- 11.Wan JM, Sit WH, Louie JC. Polysaccharopeptide enhances the anticancer activity of doxorubicin and etoposide on human breast cancer cells ZR-75-30. Int J Oncol. 2008;32:689–699. [PubMed] [Google Scholar]
- 12.Wong C, Tse P, Wong E, Leung P, Fung K, Lam C. Immunomodulatory effects of Yun Zhi and Danshen capsules in health subjects–a randomized, double-blind, placebo-controlled, crossover study. Int Immunopharmacol. 2004;4:201–211. doi: 10.1016/j.intimp.2003.12.003. [DOI] [PubMed] [Google Scholar]
- 13.Li J, Bao Y, Lam W, Li W, Lu F. Immunoregulatory and anti-tumor effects of polysaccharopeptide and Astragalus polysaccharides on tumor-bearing mice. Immunopharmacol Immunotoxicol. 2008;30:771–782. doi: 10.1080/08923970801949174. [DOI] [PubMed] [Google Scholar]
- 14.Bao YX, Wong CK, Leung SF, Chan ATC, Li PW. Clinical studies of immunomodulatory activities of Yunzhi-Danshen in patients with nasopharyngeal carcinoma. J Altern Complement Med. 2006;12:771–776. doi: 10.1089/acm.2006.12.771. [DOI] [PubMed] [Google Scholar]
- 15.Han S, Yoon Y, Ahn H, Lee H, Lee C. Toll-like receptor-mediated activation of B cells and macrophages by polysaccharide isolated from cell culture of Acanthopanax senticosus. Int Immunopharmacol. 2003;3:1301–1312. doi: 10.1016/S1567-5769(03)00118-8. [DOI] [PubMed] [Google Scholar]
- 16.Lin KI, Kao YY, Kuo HK, Yang WB, Chou A. Reishi polysaccharides induce immunoglobulin production through the TLR4/TLR2-mediated induction of transcription factor Blimp-1. J Biol Chem. 2006;281(34):24111–24123. doi: 10.1074/jbc.M601106200. [DOI] [PubMed] [Google Scholar]
- 17.Yoon YD, Han SB, Kang JS, Lee CW, Park SK. Toll-like receptor 4-dependent activation of macrophages by polysaccharide isolated from the radix of Platycodon grandiflorum. Int Immunopharmacol. 2003;3:1873–1882. doi: 10.1016/j.intimp.2003.09.005. [DOI] [PubMed] [Google Scholar]
- 18.Ando I, Tsukumo Y, Wakabayashi T, Akashi S, Miyake K. Safflower polysaccharides activate the transcription factor NF-κB via Toll-like receptor 4 and induce cytokine production by macrophages. Int Immunopharmacol. 2002;2:1155–1162. doi: 10.1016/S1567-5769(02)00076-0. [DOI] [PubMed] [Google Scholar]
- 19.Hsu HY, Hua KF, Lin CC, Lin CH, Hsu J, Wong CH. Extract of Reishi polysaccharides induces cytokine expression via TLR4-modulated protein kinase signaling pathways. J Immunol. 2004;173:5989–5999. doi: 10.4049/jimmunol.173.10.5989. [DOI] [PubMed] [Google Scholar]
- 20.Yin X, Chen L, Liu Y, Yang J, Ma C. Enhancement of the innate immune response of bladder epithelial cells by Astragalus polysaccharides through upregulation of TLR4 expression. Biochem Biophys Res Commun. 2010;397:232–238. doi: 10.1016/j.bbrc.2010.05.090. [DOI] [PubMed] [Google Scholar]
- 21.Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature. 2000;406:782–787. doi: 10.1038/35021228. [DOI] [PubMed] [Google Scholar]
- 22.Imler JL, Hoffmann JA. Toll receptors in innate immunity. Trends Cell Biol. 2001;11:304–311. doi: 10.1016/S0962-8924(01)02004-9. [DOI] [PubMed] [Google Scholar]
- 23.Medzhitov R, Preston-Hurlburt P, Janeway CA. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature. 1997;388:394–397. doi: 10.1038/41131. [DOI] [PubMed] [Google Scholar]
- 24.Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 1998;282:2085–2088. doi: 10.1126/science.282.5396.2085. [DOI] [PubMed] [Google Scholar]
- 25.Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell. 2006;124:783–801. doi: 10.1016/j.cell.2006.02.015. [DOI] [PubMed] [Google Scholar]
- 26.Shao BM, Xu W, Dai H, Tu P, Li Z, Gao XM. A study on the immune receptors for polysaccharides from the roots of Astragalus membranaceus, a Chinese medicinal herb. Biochem Biophys Res Commun. 2004;320:1103–1111. doi: 10.1016/j.bbrc.2004.06.065. [DOI] [PubMed] [Google Scholar]
- 27.Shao BM, Dai H, Xu W, Lin ZB, Gao XM. Immune receptors for polysaccharides from Ganoderma lucidum. Biochem Biophys Res Commun. 2004;323:133–141. doi: 10.1016/j.bbrc.2004.08.069. [DOI] [PubMed] [Google Scholar]
- 28.Wang J, Dong B, Tan Y, Yu S, Bao YX. A study on the immunomodulation of polysaccharopeptide through the TLR4-TIRAP/MAL-MyD88 signaling pathway in PBMCs from breast cancer patients. Immunopharmacol Immunotoxicol. 2013;35:497–504. doi: 10.3109/08923973.2013.805764. [DOI] [PubMed] [Google Scholar]
- 29.Zeytun A, Chaudhary A, Pardington P. Induction of cytokines and chemokines by Toll-like receptor signaling: strategies for control of inflammation. Crit Rev Immunol. 2010;30:53–67. doi: 10.1615/CritRevImmunol.v30.i1.40. [DOI] [PubMed] [Google Scholar]
- 30.Schaefer TM, Desouza K, Fahey JV. Toll-like receptor (TLR) expression and TLR-mediated cytokine/chemokine production by human uterine epithelial cells. Immunology. 2004;112:428–436. doi: 10.1111/j.1365-2567.2004.01898.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Wong CK, Bao YX, Wong E, Leung PC, Fung KP, Lam C. Immunomodulatory activities of Yunzhi and Danshen in post-treatment breast cancer patients. Am J Chin Med. 2005;33:381–395. doi: 10.1142/S0192415X05002990. [DOI] [PubMed] [Google Scholar]
- 32.Hsu HY, Wen MH. Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of IL-1 gene expression. J Biol Chem. 2002;277:22131. doi: 10.1074/jbc.M111883200. [DOI] [PubMed] [Google Scholar]
- 33.Pålsson-McDermott EM, O’Neill LA. Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology. 2004;113:153–162. doi: 10.1111/j.1365-2567.2004.01976.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Marcato LG, Ferlini AP, Bonfim RC, Ramos-Jorge ML, Ropert C. The role of Toll-like receptors 2 and 4 on reactive oxygen species and nitric oxide production by macrophage cells stimulated with root canal pathogens. Oral Microbiol Immunol. 2008;23:353–359. doi: 10.1111/j.1399-302X.2008.00432.x. [DOI] [PubMed] [Google Scholar]
- 35.Hume DA. The mononuclear phagocyte system. Curr Opin Immunol. 2006;18:49–53. doi: 10.1016/j.coi.2005.11.008. [DOI] [PubMed] [Google Scholar]
- 36.Schepetkin IA, Quinn MT. Botanical polysaccharides: macrophage immunomodulation and therapeutic potential. Int Immunopharmacol. 2006;6:317–333. doi: 10.1016/j.intimp.2005.10.005. [DOI] [PubMed] [Google Scholar]
- 37.Aziz M, Jacob A, Matsuda A, Wu R, Zhou M. Pre-treatment of recombinant mouse MFG-E8 downregulates LPS-induced TNF-α production in macrophages via STAT3-mediated SOCS3 activation. PLoS One. 2011;6:e27685. doi: 10.1371/journal.pone.0027685. [DOI] [PMC free article] [PubMed] [Google Scholar]