Skip to main content
. 2014 Sep 3;36(5):9703. doi: 10.1007/s11357-014-9703-7

Table 1.

Sequences of the primers used for RT-qPCR and GenBank accession numbers

Gene Forward primer Reverse primer Accession number
P-selectin acaggcagccctccaatgtgtg atttgacggctctgcacacggg [NM_013114.1]
E-selectin tgcttcccgtctttgccacacc tccgtccttgctcttctgtgcg [NM_ 017211.2]
VCAM-1 tgctcctgacttgcagcaccac tgtcatcgtcacagcagcaccc [NM_ 012889.1]
ICAM-1 tgcagccggaaagcagatggtg atggacgccacgatcacgaagc [NM_012967.1]
GAPDH gggcagcccagaacatca tgaccttgcccacagcct [NM_017008]

ICAM intercellular adhesion molecule, VCAM vascular adhesion molecule, GAPDH glyceraldehyde-3-phosphate dehydrogenase