TABLE 2.
PCR primers
| Primer | Sequence (5′-3′) | Specificity | Locationa (5′-3′) | Region of 16S rRNAb | Annealing temp (°C) | Amplicon sizec (bp) |
|---|---|---|---|---|---|---|
| UniF | GAGAGTTTGATCCTGGCTCAG | Most bacteria | 7-27 | 5′-V1 | 60 | 391-406 |
| LactoF | TGGAAACAGRTGCTAATACCG | All lactobacilli | 157-167 | V2.1-V2.2 | 62 | 231-233 |
| LactoR | GTCCATTGTGGAAGATTCCC | All lactobacilli | 379-360 | V2.2-V3 | ||
| LcaseF | GCACCGAGATTCAACATGG | L. casei/L. paracasei | 86-104 | V1 | 60 | 117 |
| LrhamF | TGCTTGCATCTTGATTTAATTTTG | L. rhamnosus | 81-104 | V1 | 62 | 122 |
| LcaseR | GGTTCTTGGATYTATGCGGTATTAG | L. casei group | 196-169 | V2.2 | ||
| LfermR | GCACCTGATTGATTTTGGTCG | L. fermentum | 86-94 | V1 | 60 | 317 |
| LdelbF | GGRTGATTTGTTGGACGCTAG | L. delbrueckii | 92-102 | V1 | 60 | 138 |
| LdelbR | GCCGCCTTTCAAACTTGAATC | L. delbrueckii | 219-199 | V2.2 | ||
| LgassR | CAGTTACTACCTCTATCTTTCTTCACTAC | L. gasseri | 470-442 | V3 | 60 | 322 |
| LsaliF | CGAAACTTTCTTACACCGAATGC | L. salivarius | 67-91 | V1 | 60 | 332 |
| LcrisF | AGCGAGCGGAACTAACAGATTTAC | L. crispatus | 65-89 | V1 | 60 | 154 |
| LgallF | CGGTAATGACGCTGGGGAC | L. gallinarum | 78-97 | V1 | 64 | 128 |
| LultF | GAGCGGAACCAGCAGATCTG | L. ultunensis | 68-87 | V1 | 60 | 151 |
| LcrisR | AGCTGATCATGCGATCTGCTT | L. acidophilus groups A1-A4d | 205-185 | V2.2 | ||
| T7 primer | TAATACGACTCACTATAGGG | T7 promoter |
Locations relative to positions in the E. coli 16S rRNA gene.
Variable regions according to Neefs et al. (28).
Theoretical amplicon sizes based on the reference sequence for that species; for L. gasseri, L. salivarius, and L. fermentum, either LactoF or LactoR was the complementary primer.
L. acidophilus groups according to Johnson et al. (15).