Table 2. List of primers designed in this study, size of PCR product, target gene, and specificity of primers.

Primer pair	Sequences (5’– 3’)	Size of PCR product (bp)	Target	Specificity a
Mul-15040-F	ATTTTCGCGATTTTGGAGTT	312	Hypothetical protein containing a region of putative bacillithiol system oxidoreductase,YpdA family	American mulberry-infecting and Italian olive-associated strains of X. fastidiosa
Mul-15040-R	TTCTTGTGTACTCCGCCTCA

^aPrimers amplified product only from tested mulberry and olive strains of X. fastidiosa.