Table S1.
Bacterial strains, plasmids, and PCR primers used in this study
| Strain or plasmid | Relevant genotype/comments | Source |
| Strains | ||
| Sco A3(2) | ||
| S129 | J1981 ΔrbpA::apr (AprR) | 15 |
| Eco | ||
| ET12567 (pUZ8002) | dam, dcm, hsdM; pUZ8002 is a nontransmissible derivative of RK2 (CmR and KmR) | 36 |
| BL21 (DE3) | Eco B F− ompT hsdS(rB−mB−) dcm gal λ(DE3) endA Hte (TetR) | 37 |
| BL21 (DE3) pLysS | BL21(DE3) pLysS (CmR) | 37 |
| BTH101 | cya-99 (SpcR) used for BTH analysis | 38 |
| Rosetta 2 | BL21(DE3) expressing rare codon tRNA genes | Novagen |
| Plasmids | ||
| pBluescript II SK+ | E. coli cloning vector; ori pUC18 (AmpR) | |
| pKT25 | Two-hybrid vector; T25 fragment of Bordetella pertussis CyaA for N-terminal fusions (KmR) | 38 |
| pUT18 | Two-hybrid vector; T18 fragment of Bordetella pertussis CyaA for C-terminal fusions (AmpR) | 38 |
| pKT25-hrdB | hrdB (codons 211–511) fused to T25 in pKT25 (KmR) | 15 |
| pKT25-sigA | Mtb sigA (codons 1–528) fused to T25 in pKT25 (KmR) | 15 |
| pKT25-sigA(RT) | sigA (E248R/K251T; codons 1–528) fused to T25 in pKT25 (KmR) | This study |
| pKT25-sigA(VR) | sigA (L257V/Y258R; codons 1–528) fused to T25 in pKT25 (KmR) | This study |
| pKT25-sigA(RTVR) | sigA (E248R/K251T/L257V/Y258R; codons 1–528) fused to T25 in pKT25 (KmR) | This study |
| pUT18-rbpA(Mtb) | Mtb rbpA (codons 1–111) fused to T18 in pUT18 (AmpR) | 15 |
| pUT18-rbpA(Sco) | Mtb rbpA (codons 1–124) fused to T18 in pUT18 (AmpR) | 15 |
| pSETΩ | Integrative cloning vector (SpcR) | 15 |
| pSX530 | pSETΩ containing at the BamHI site a BglII-fragment including rbpA | 15 |
| pSX530(R80A) | As pSX530 but with rbpA-R80A mutation | This study |
| pSX530(M85A) | As pSX530 but with rbpA-M85A mutation | This study |
| pET15b | Eco expression vector (His6-tagged; AmpR) | Novagen |
| pET15b-sigA | Mtb sigA cloned in pET15b as an NdeI-BglII fragment | This study |
| pET15b-sigA(RT) | Mtb sigA (E248R/K251T) cloned in pET15b as an NdeI-BglII fragment | This study |
| pET15b-sigA(VR) | Mtb sigA (L257V/Y258R) cloned in pET15b as an NdeI-BglII fragment | This study |
| pET15b-sigA(RTVR) | Mtb sigA (E248R/K251T/L257V/Y258R) cloned in pET15b as an NdeI-BglII fragment | This study |
| pET20b | Eco expression vector (native; AmpR) | Novagen |
| pSX500 | pET20b containing Mtb rbpA cloned as NdeI-BamHI fragment | 15 |
| pSX500(R79A) | pET20b containing Mtb rbpA-R79A cloned as NdeI-BamHI fragment | This study |
| pSX500(M84A) | pET20b containing Mtb rbpA-R79A cloned as NdeI-BamHI fragment | This study |
| pET SUMO | Eco expression vector (N-terminal His6/SUMO fusion; KmR) | Life Technologies |
| pET28 | Eco expression vector (His6-tagged; KmR) | Novagen |
| pET28-rbpA | Mtb rbpA cloned into pET28 | This study |
| pET28-rbpA(R79A) | As pET28-rbpA but with R79A allele | This study |
| pSUMO-sigA/rbpA | Mtb sigA (codons 224–364) and rbpA (codons 1–111) chemically synthesized and cloned as a BamHI-HindIII fragment into a pET SUMO, generating an SUMO–sigA fusion | This study |
| pSUMO-rbpA(1–111) | pET SUMO containing Mtb rbpA (codons 1–111) fused to the C terminus of SUMO as a BamHI-HindIII fragment | This study |
| pSUMO-rbpA(1–71) | pET SUMO containing Mtb rbpA (codons 1–71) fused to the C terminus of SUMO as a BamHI-HindIII fragment | This study |
| pSUMO-rbpA(72–111) | pET SUMO containing Mtb rbpA (codons 72–111) fused to the C terminus of SUMO as a BamHI-HindIII fragment | This study |
| PCR primers | ||
| Plasmid constructs | ||
| pSUMO-RbpA(1–111) | GGATCCCATATGGCTGATCGTGTCCTGAGG | |
| AAGCTTTCAGCCG CGCCGACGTGACCGAATG | ||
| pSUMO-RbpA(1–71) | GGATCCCATATGGCTGATCGTGTCCTGAGG | |
| AAGCTTTCACTCGGGCAGGTCGCCCTCGATCAG | ||
| pSUMO-RbpA(72–111) | GGATCCCATATGGAGCCGAAGAAGGTTAAGCCG | |
| AAGCTTTCAGCCG CGCCGACGTGACCGAATG |
Primer sequences (5′ to 3′) are listed with restriction sites indicated in bold.