Skip to main content
. 2015 Jun 18;10(6):e0129810. doi: 10.1371/journal.pone.0129810

Table 2. Details of primers.

Target Liposcelis species Primer Name Primer Sequence (5’-3’) Length (bp) GC% *Tm **ΔG ^ any ^^ 3’ Intended use
Liposcelis brunnea BruCo5F GGGGTTTTAGGGTTTGTGGTA 21 47.2 60.0 0.8 2 2 Endpoint/qPCR multiplex
BruCo5R AATGTCGCCAACCATCTAAAG 21 42.9 59.1 0 4 2 Endpoint/qPCR multiplex
BruCo6F TTTATGCGATAGGAGCGATTG 21 42.9 60.2 0.5 4 2 Single PCR
BruCo6R CATCCAACCCGACAGTAAACA 21 47.7 60.7 1.0 3 0 Single PCR
Liposcelis bostrychophila BosCo7F CGATCCCTACCGGAGTTAAAG 21 52.4 60.0 0.7 4 1 Endpoint PCR multiplex
BosCo7R TGGGCAACAACATAGTATCTATCG 24 41.7 60.3 0.7 6 4 Endpoint PCR multiplex
BosCo8F ATGCTCTCAATCGGAGCTCTAG 22 50.0 60.1 0.7 6 4 qPCR multiplex
BosCo8R ACTTTAACTCCGGTAGGGATCG 22 50.0 60.7 0.9 4 2 qPCR multiplex
BosCo9F TGGGCTAATCTCTCACATCATCT 23 43.5 60.1 0.9 3 3 Single PCR
Liposcelis decolor DecCo10F CCGGCTTTTGGTATTATTTCAC 22 40.9 59.8 0.7 4 1 Single PCR
DecCo10R ATTATCCCCATTACCCCAAA 20 40.0 58.0 0.9 3 0 Single PCR
DecCo11F CGAGCTTATTTTACTTCTGCGACT 24 41.7 60.4 0.9 4 1 Endpoint/qPCR multiplex
DecCo11R TGATCCATACAACGTAGCTAGTCA 24 41.7 58.9 1.0 6 2 Endpoint/qPCR multiplex
Liposcelis obscura ObsCo12F GGACAGGGTGGACGGTTTATC 21 57.1 62.8 1.0 3 1 qPCR multiplex
ObsCo12R CTGATTCCTGCTAAATGAAGAGAG 24 41.7 58.8 0.9 3 0 qPCR multiplex
ObsCo13F AGCTATTGCTCACGGAGGATA 21 47.6 59.0 0 6 4 Endpoint PCR multiplex
ObsCo13R CCAATTGCGGACATAGCATAA 21 42.9 60.8 1.0 6 1 Endpoint PCR multiplex
Liposcelis pearmani PeaCo14F CTGACTTTTTCCCCCTTCACT 21 47.6 59.6 0.9 3 1 qPCR multiplex
PeaCo14R GCCAGGGTGTGAGATTCTAAA 21 47.6 59.2 0.9 5 3 Endpoint/qPCR multiplex
PeaCo15F TGGTGTGTGAGCAGGTATGGT 21 52.4 61.5 0.8 2 0 Endpoint PCR multiplex

Sequences of Liposcelis species specific primers and their thermodynamic features used for endpoint PCR and real-time TaqMan qPCR.

*The melting temperature of the primer calculated using Primer 3;

**Plot ΔG value in plot calculated by mFOLD;

^ The self-complementarity score of the oligo (tendency of oligo to anneal to itself or form a secondary structure) calculated using Primer 3;

^^3’ self-complementarity of the oligo (tendency to form a primer-dimer with itself) calculated using Primer3.