Table 3. Details of TaqMan probes.
| Target Liposcelis species | Probe | Probe Sequence (5’-3’) | Length (bp) | GC% | *ΔG | ^ any | ^^ 3’ | Reporter dye | Spectra (nm) | Quencher dye | Channel used in Rotor Gene | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EX | EM | |||||||||||
| Liposcelis decolor | DecCo11P | TGCTGTTCCTACAGGAATCAAGGTTTT | 27 | 41 | 1.0 | 8 | 0 | 6-FAM | 495 | 520 | BHQ2 | Green |
| Liposcelis brunnea | BruCo5P | TGTTTACTGTCGGGTTGGATGTGGA | 25 | 48 | 0.9 | 3 | 0 | HEX | 535 | 554 | ZEN-IABkFQ | Yellow |
| Liposcelis obscura | ObsCo12P | CCTCAGCTATTGCTCACGGAGGA | 23 | 56 | 0.9 | 6 | 4 | 6-ROXN | 575 | 602 | BHQ2 | Orange |
| Liposcelis bostrychophila | BosCo8P | GGGCATGGATGTGGATAGACGAGC | 24 | 58 | 1.0 | 4 | 2 | Cy5 | 647 | 667 | BHQ2 | Red |
| Liposcelis pearmani | PeaCo14P | AGGGAGTCGGAACCGGGTGAA | 21 | 62 | 0.8 | 5 | 0 | Quasar705 | 690 | 705 | BHQ3 | Crimson |
Liposcelis species specific probes used for multiplex TaqMan qPCR.
*Plot ΔG value in plot calculated by mFOLD;
^ The self-complementarity score of the oligo (tendency of oligo to anneal to itself or form a secondary structure) calculated using Primer 3;
^^3’ self-complementarity of the oligo (tendency to form a primer-dimer with itself) calculated using Primer3; EX is the excitation spectra and EM is the emission spectra.