Y-Chromosomal DNA Variation in Pakistan

Abstract

Eighteen binary polymorphisms and 16 multiallelic, short-tandem-repeat (STR) loci from the nonrecombining portion of the human Y chromosome were typed in 718 male subjects belonging to 12 ethnic groups of Pakistan. These identified 11 stable haplogroups and 503 combination binary marker/STR haplotypes. Haplogroup frequencies were generally similar to those in neighboring geographical areas, and the Pakistani populations speaking a language isolate (the Burushos), a Dravidian language (the Brahui), or a Sino-Tibetan language (the Balti) resembled the Indo-European–speaking majority. Nevertheless, median-joining networks of haplotypes revealed considerable substructuring of Y variation within Pakistan, with many populations showing distinct clusters of haplotypes. These patterns can be accounted for by a common pool of Y lineages, with substantial isolation between populations and drift in the smaller ones. Few comparative genetic or historical data are available for most populations, but the results can be compared with oral traditions about origins. The Y data support the well-established origin of the Parsis in Iran, the suggested descent of the Hazaras from Genghis Khan’s army, and the origin of the Negroid Makrani in Africa, but do not support traditions of Tibetan, Syrian, Greek, or Jewish origins for other populations.

Introduction

The earliest evidence of Paleolithic human presence in the Indo-Pakistani subcontinent consists of stone implements found scattered around the Soan River Valley in northern Pakistan (Hussain 1997). Despite the lack of fossil evidence, these tools appear to indicate the presence of hominids in the subcontinent as early as 200,000–400,000 years ago (Wolpert 2000) and thus are likely to have been associated with archaic Homo species. Pakistan lies on the postulated southern coastal route followed by anatomically modern H. sapiens out of Africa, and so may have been inhabited by modern humans as early as 60,000–70,000 years ago. There is evidence of cave dwellers in Pakistan’s northwest frontier, but fossil evidence from the Paleolithic has been fragmentary (Hussain 1997). Evidence has been uncovered at Mehrghar, in southwestern Pakistan, indicating Neolithic settlements from as long ago as 7,000 b.c. (Jarrige 1991), which were followed by the Indus Valley civilizations (including the cities of Harappa and Mohenjodaro) that flourished in the 3d and 2d millennia b.c. (Dales 1991). Around 1500 b.c., the Indo-European–speaking nomadic pastoral tribes from further north—often called the Aryans—crossed the Hindu Kush Mountains into the subcontinent. Subsequent historical events include the invasion of Alexander the Great (327–325 b.c.) and the Arab and Muslim conquest from 711 a.d. onwards (Wolpert 2000).

The present population of Pakistan consists of >150 million individuals (according to current WHO figures) who belong to at least 18 ethnic groups and speak >60 languages (Grimes 1992). Most of these languages are Indo-European, but they also include an isolate, Burushaski; a Dravidian language, Brahui; and a Sino-Tibetan language, Balti. Punjabi-speaking individuals form the majority population of Pakistan, but they represent a complex admixture of ethnic castes and groups (Ibbetson 1883) and are not analyzed here; 12 ethnic groups are included in the present survey. The information available about them is summarized in table 1, together with hypotheses about their origins (Mehdi et al. 1999). Although some of these hypotheses are well-supported (e.g., the origin of the Parsis in Iran), most are based on oral traditions and have not been tested against other sources of evidence.

Table 1.

Pakistani Ethnic Groups Studied

Ethnic Group	Locationa	Language Family	Census Sizeb	Suggested Origin(s)
Baluch	Baluchistan	Indo-European	4,000,000	Syria: Aleppo (Quddus 1990)
Balti	Eastern Baltistan	Sino-Tibetan	300,000	Tibet (Backstrom 1992)
Brahui	Baluchistan: Kalat State, Sarawan and Jhalawan regions	Dravidian	1,500,000	West Asia (Hughes-Buller 1991)
Burusho	Karakorum Mountains: Hunza, Nagar, and Yasin	Language isolate	50,000–60,000	Alexander’s army (Biddulph 1977)
Hazara	Southern Baluchistan: Quetta and NWFP: Parachinar	Indo-European	NA	Genghis Khan’s soldiers (Bellew 1979)
Kalash	NWFP: Hindu Kush Mountains: Bumburet, Rambur, and Birir valleys	Indo-European	3,000–6,000	Greeks (Robertson 1896) or “Tsyam,” possibly Syria (Decker 1992)
Kashmiri	Kashmir Valley	Indo-European	NA	Jewish (Ahmad 1952)
Makrani Baluch	Makran coast	Indo-European	NA	West Asia (Hughes-Buller 1991)
Negroid Makrani	Makran coast	Indo-European	NA	Rajput (Quddus 1990); Africa?
Parsi	Karachi	Indo-European	A few thousand	Iran, via India (Nanavutty 1997)
Pathan	NWFP and Baluchistan	Indo-European	17,000,000	Jewish (Ahmad 1952), Greek or Rajput (Bellew 1998; Caroe 1958)
Sindhi	Sindh	Indo-European	15,300,000	Mixed (Burton 1851)

^aNWFP = North West Frontier Province.

^bNA = not available.

Scanty genetic data are available for these Pakistani ethnic groups. Early studies of the ABO blood groups and classical protein markers did not include all groups and mostly classified them according to their place of residence. A population tree based on 54 classical enzyme markers places the Hazara and Pathans in the West Asian cluster containing the northern Caucasoids (Cavalli-Sforza et al. 1994). In another population tree, based on 47 classical protein polymorphisms, the Pakistani samples form a small subcluster within the Indo-European speakers from India (Cavalli-Sforza et al. 1994).

The Y chromosome provides a unique source of genetic evidence (Tyler-Smith 1999; Jobling and Tyler-Smith 2000). It carries the largest nonrecombining segment in the genome and contains numerous stable binary markers, including base substitutions (see, e.g., Underhill et al. 1997) and retroposon insertions (Hammer 1994; Santos et al. 2000), which can be used in combination with more-rapidly evolving markers, such as microsatellites (see, e.g., Ayub et al. 2000). Consequently, very detailed Y phylogenies can be constructed that allow male-specific aspects of genetic history to be investigated. These are strongly influenced by the small effective population size of the Y chromosome, leading to rapid genetic drift, and by the practice of patrilocality in many societies, leading to high levels of geographical differentiation of Y haplotypes. Notwithstanding the work of Qamar et al. (1999) on the analysis of YAP+ chromosomes (comprising ∼2.6% of the total) and analyses of STR variation (Ayub et al. 2000; Mohyuddin et al. 2001), little work has been carried out on Pakistani Y chromosomes. Therefore, we have now performed an extensive analysis of Pakistani Y lineages, to determine what light they can shed on the origins and genetic history of the subgroups that make up the Pakistani population.

Material and Methods

Samples

The Y chromosomes of 718 unrelated male subjects, belonging to 12 ethnic groups of Pakistan, were analyzed (tables 1 and 2; fig. 1). Informed consent was obtained from all participants in this study. An Epstein Barr virus–transformed lymphoblastoid cell line was established from each individual, and DNA was extracted from these cell lines for analysis.

Table 2.

Diversity, Sample Size (n), and Number of Individuals Belonging to Each Y Haplogroup in 12 Pakistani Ethnic Groups

			No. of Individuals in Haplogroup
Population	Diversity	n	1	2	3	8	9	10	12	13	21	26	28
Baluch	.7908	59	11	0	17	1	7	0	0	0	5	1	17
Balti	.7692	13	2	1	6	0	2	0	0	0	0	0	2
Brahui	.7516	110	9	11	43	3	31	2	1	1	0	1	8
Burusho	.8065	94	26	7	26	0	7	8	0	0	0	4	16
Hazara	.5573	23	14	1	0	0	1	7	0	0	0	0	0
Kalash	.7558	44	4	17	8	0	4	0	0	0	0	0	11
Kashmiri	.6212	12	3	0	7	0	2	0	0	0	0	0	0
Makrani Baluch	.8100	25	6	0	7	1	6	0	0	0	1	0	4
Makrani Negroid	.8352	33	6	4	10	3	6	0	0	0	1	0	3
Parsi	.7441	90	24	3	7	0	35	0	0	0	5	0	16
Pathan	.7539	93	10	15	42	0	6	0	0	0	2	6	12
Sindhi	.6937	122	15	11	60	0	25	0	0	0	3	0	8
Overall	.8011	718	130	70	233	8	132	17	1	1	17	12	97

Figure 1.

Distribution of Y haplogroups in Pakistan. A, Unrooted maximum-parsimony tree showing Y haplogroups (numbers in circles) and mutations (on lines). Circle area is proportional to frequency in Pakistan. B–F, Frequencies of Y haplogroups in populations sampled. Circles represent populations and are placed in the approximate geographical location sampled; area is proportionate to sample size. BAL = Baluch; BLT = Balti; BRU = Brahui; BSK = Burusho; HZR = Hazara; KAL = Kalash; KSR = Kashmiri; MAKB = Makrani Baluch; MAKN = Makrani Negroid; PKH = Pathan; PRS = Parsi; and SDH = Sindhi. Haplogroup color codes are as in A. B, Haplogroup 1. C, Haplogroup 3. D, Haplogroups 21, 8, and 10. E, Haplogroup 9. F, Haplogroup 28.

Binary Polymorphism Typing

We typed 15 SNPs, an Alu insertion (Hammer 1994; Hammer and Horai 1995), a LINE1 insertion (Santos et al. 2000), and the 12f2 deletion (Casanova et al. 1985). The base substitutions were: 92R7 C→T (Mathias et al. 1994); M9 C→G (Underhill et al. 1997); SRY-2627 C→T (Bianchi et al. 1997); SRY-1532 A→G→A (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) A→G (Seielstad et al. 1994); SRY-8299 G→A (Santos et al. 1999a); Apt G→A (Pandya et al. 1998); SRY +465 C→T (Shinka et al. 1999); LLY22g C→A and Tat T→C transition (Zerjal et al. 1997). In addition, the M17 marker (Underhill et al. 1997) was typed, by use of the primers GTGGTTGCTGGTTGTTACGT and AGCTGACCACAAACTGATGTAGA followed by AflIII digestion of the PCR product; the ancestral allele was not digested. The M20 marker (Underhill et al. 1997) was genotyped, by use of the primers CACACAACAAGGCACCATC and GATTGGGTGTCTTCAGTGCT followed by SspI digestion; the A→G mutation destroys the site at position 118 in the 413-bp product. M11 (Underhill et al. 1997) was typed, using the primers TTCATCACAAGGAGCATAAACAA and CCCTCCCTCTCTCCTTGTATTCTACC followed by digestion with MspI. The 215-bp product was digested to 193-bp and 22-bp fragments in the derived allele. The RPS4Y C→T mutation (Bergen et al. 1999) was detected by BslI restriction digestion of a 528-bp PCR product obtained by use of the primers CCACAGAGATGGTGTGGGTA and GAGTGGGAGGGACTGTGAGA. The ancestral C allele contains two sites, and the derived T allele contains one. M48 (Underhill et al. 1997), A→G, was typed by allele-specific PCR using the discriminating primers TGACAATTAGGATTAAGAATATTATA and TGACAATTAGGATTAAGAATATTATG and the common primer AAAATTCCAAGTTTCAGTGTCACATA to generate specific 145-bp products. The set of Y binary marker alleles carried by a single individual will be referred to as “the Y haplogroup.”

Of the 718 samples, 717 fell into haplogroups expected on the basis of the known phylogeny, but one Pathan sample (PKH134) failed to amplify at the SRY –1532 and M17 loci. He was assigned to haplogroup 3 on the basis of alternative SRY –1532 primers (details on request) and his STR profile.

Y-STR Typing

Five trinucleotide-repeat polymorphisms (DYS388, DYS392, DYS425, DYS426, and DYS436), ten tetranucleotide-repeat polymorphisms (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, and DYS439) and one pentanucleotide microsatellite (DYS438) were typed in all Y chromosomes. Three multiplex PCR reactions were performed for all Y-STRs, in a10-μl final reaction volume containing 20 ng genomic DNA, as described elsewhere (Thomas et al. 1999; Ayub et al. 2000). PCR products were run on an ABI 377 sequencer. ABIGS350 TAMRA was used as the internal lane standard. The GENESCAN and GENOTYPER software packages were used to collect the data and to analyze fragment sizes. Y-STR alleles were named according to the number of repeat units they contain.The number of repeat units was established through the use of sequenced reference DNA samples. Allele lengths for DYS389b were obtained by subtraction of the DYS389II allele length from DYS389I.

Y-STR duplications were found at several loci. DYS393 was duplicated in PKH165 (13 and 15) and DYS437 was duplicated in SDH181 (8 and 9). A more complex pattern was found in DYS425, where two to four alleles were found in 36 individuals from haplogroups 8, 9, 13, and 21.

Data Analysis

Principal-components analysis was carried out on haplogroup frequencies by use of the ViSta (Visual Statistics) system software, version 5.0.2 (Young and Bann 1996). For graphic representation, the first and second principal components were plotted by the Microsoft Office Suite Excel Package on Windows 2000. Biallelic polymorphism data for various world populations used in the analysis were obtained from Hammer et al. (2001). Admixture was estimated by use of three different measures: Long’s weighted least-squares (WLS) measure (Long 1991); mR, a least-squares estimator (Roberts and Hiorns 1965); and mρ (Helgason et al. 2000).

Analysis of molecular variance (AMOVA) was carried out by use of the Arlequin package (Schneider et al. 1997). AMOVA measures the proportions of mutational divergence found within and between populations, respectively. Although much of the variation at the rapidly mutating microsatellite loci is expected to have been produced in the different Pakistani subpopulations, the unique mutation events at the binary loci are much older and have not occurred in the context of the subdivision of the Pakistani population. We devised the following strategy to exploit the maximum amount of relevant mutational information from the Y-chromosome haplotypes. STR variation within haplogroups was used to calculate population pairwise Φ_ST values for each individual haplogroup. For each population pair, a weighted mean Φ_ST was calculated, where the value obtained for each haplogroup was weighted according to the proportion of pairwise comparisons involving that haplogroup. In the absence of a particular haplogroup from one population, A, of the pair A and B, Φ_ST was set to 1, and the number of pairwise comparisons was taken as the number of chromosomes carrying that haplogroup in B. Values of Φ_ST based on STRs alone or on STRs plus binary markers, with binary markers given a 10-fold higher weighting, were calculated for comparison. In all of these analyses, the distance matrix used consisted of the number of steps by which each pair of haplotypes differed. Mantel tests for the significance of correlations between Φ_ST values were carried out in Arlequin, and multidimensional scaling (MDS) plots were constructed by use of the SPSS version 7.0 software package.

Median-joining networks were constructed by Network 2.0b (Bandelt et al. 1999). A weighting scheme with a five-fold range was used in the construction of the networks. The weights assigned were specific for each haplogroup and took into account the Y-STR variation across the haplogroup in the whole Pakistani population. The following weights were used: variance 0-0.09, weight 5; variance 0.1-0.19, weight 4; variance 0.2-0.49, weight 3; variance 0.5-0.99, weight of 2; and variance ⩾1.00, weight 1. Despite this, the network for haplogroup 1 contained many high dimensional cubes and was resolved by applying the reduced median and median joining network methods sequentially. The reduced median algorithm (Bandelt et al. 1995) was used to generate a *.rmf file and the median joining network method was applied to this file.

BATWING (Wilson and Balding 1998), Bayesian Analysis of Trees With Internal Node Generation, was used to estimate the time to the most recent common ancestor (TMRCA) of a set of chromosomes. This program uses a Markov chain Monte Carlo procedure to generate phylogenetic trees and associated parameter values consistent with input data (a set of Y haplotypes) and genetic and demographic models. The genetic model assumes single-step mutations of the STRs and the demographic model chosen was exponential growth from an initially constant-sized population, with or without subdivision in different runs of the program. All 16 STR loci were used; locus-specific mutation rate prior probabilities based on the data of Kayser et al. (Kayser et al. 2000) were constructed for the loci available as gamma distributions of the form gamma(a, b) where a = (1 + number of mutations observed by Kayser et al.), and b = (1 + number of meioses). For loci not investigated by Kayser et al., the distribution gamma (1,416) was used, which has a mean of 0.0024. A generation time of 25 years was assumed. Thus the 95% confidence intervals given take into account uncertainty in mutation rate, population growth and (where appropriate) subdivision, but not generation time.

Results

Y-Chromosome Binary Polymorphisms

The 18 binary markers used identify 20 haplogroups in worldwide populations (fig. 1A), but only 11 were found in Pakistan, and 5 accounted for 92% of the sample (fig. 1 and table 2). Haplogroups 1 and 9 were present in all Pakistani populations examined, haplogroup 3 was present in all except the Hazaras, and haplogroup 28 was present in all except the Hazaras and the Kashmiris. Southwestern populations show higher frequencies of hg 9 and the YAP+ haplogroups 21 and 8 than northeastern populations (figs. 1D–E), but, overall, little geographical clustering of haplogroup frequencies is apparent within the country.

Principal-Components Analysis

We wished to compare the Pakistani Y haplogroup data with data from populations from the rest of the world. No suitable data set was available for the entire set of 18 markers, but the data of Hammer et al. (2001) allowed all but 5 to be used, because the same or phylogenetically equivalent markers were reported. The principal-components analysis (fig. 2A) shows some differences from the original analysis of Hammer et al., the main one being the lesser separation of the African populations. This is due, to a large extent, to the subset of markers used, which does not include many of the Africa-specific ones. Most Pakistani populations cluster with South Asian and Middle Eastern populations, and are close to Northern African, Central Asian and European populations, thus showing a general similarity with geographically close populations. The one exception is the Hazara, who are quite distinct. A similar analysis of the Pakistani populations alone, using all of the binary markers (fig. 2B), confirms the difference between the Hazaras and the other populations and also more clearly shows the distinctness of the Kalash and the Parsis. It is striking that the language isolate–speaking Burusho and the Dravidian-speaking Brahuis do not stand out in these analyses.

Figure 2.

Principal-components analysis of Y haplogroup frequencies. A, World data using 13 markers. B, Pakistani data using 18 markers. Population codes are as in figure 1. World data are shown as squares. Within Pakistan, Indo-European speakers are indicated by blackened triangles, Sino-Tibetan speakers by an unblackened triangle, Dravidian speakers by a circle, and the language-isolate Burusho by a diamond.

Admixture Estimates

Hypotheses about population origins (table 1) can be considered as quantitative questions about admixture. For example, to test the possibility that the Baluch Y chromosomes have a Syrian origin, we can ask what proportion of the Baluch Ys are derived from Syria and what proportion are from Pakistan (considered to be the Pakistani sample minus the Baluch). Data on suggested source populations were taken from the literature and three measures of admixture were calculated. The three estimates gave broadly consistent results, with small systematic differences: typically mρ > mR > Long’s WLS for the estimated contribution from the external source population (table 3). These results provide evidence for an external contribution to the Hazaras, Kalash, Negroid Makrani, and Parsis but not to the other populations.

Table 3.

Admixture Estimates

		Admixture Estimate
Pakistaniand SourcePopulations	Long's WLS	mR	mρ
Baluch:
Syriaa	−.08	−.1	0
Pakistan	1.08	1.1	1
Balti:
Tibetb	−.06	−.11	0
Pakistan	1.06	1.11	1
Burusho:
Greecec	−.29	−.22	0
Pakistan	1.29	1.22	1
Hazara:
Mongoliab	.67	.52	.41
Pakistan	.33	.48	.59
Kalash:
Greecec	.4	.32	.23
Pakistan	.6	.68	.77
Kashmiri:
Jewsa	−.46	−.36	0
Pakistan	1.46	1.36	1
Negroid Makrani:
Sub-Saharan Africab	.12	.12	.13
Pakistan	.88	.88	.88
Pathan:
Greecec	−.03	−.16	0
Pakistan	1.03	1.16	1
Jewsa	−.22	−.55	0
Pakistan	1.22	1.55	1
Parsis:
Irand	1.21	1.06	1
Pakistan	−.21	−.06	0

^aHammer et al. 2000.

^bKarafet et al. 1999.

^cRosser et al. 2000.

^dQuintana-Murci et al. 2001.

Y-Chromosome STR Polymorphisms

Y-STR polymorphisms were studied to obtain a more detailed view of Y variation, among the different Pakistani ethnic groups, that would be less biased by the marker-ascertainment procedure. The diversity of Y-STR haplotypes (table 4) was lowest for the Hazara (0.893) as suggested by previous analyses (Ayub et al. 2000).

Table 4.

STR Variation within the 12 Ethnic Groups from Pakistan^[Note]

	Value for Population
Variable	BAL	BLT	BRU	BSK	HZR	KAL	KSR	MAKB	MAKN	PRS	PKH	SDH
n	59	13	110	94	23	44	12	25	33	90	93	122
ka	48	12	85	63	11	26	8	24	30	60	72	101
HDb±SE	.988 ± .027	.987 ± .069	.973 ± .024	.987 ± .024	.893 ± .040	.952 ± .030	.894 ± .067	.997 ± .036	.992 ± .033	.974 ± .025	.984 ± .028	.995 ± .023

Note.— The populations are represented by their three- or four-letter codes, as defined in figure 1.

^ak = Number of lineages.

^bHD = Haplotype diversity.

The 16 Y-STRs defined 502 Y haplotypes, the vast majority being observed in single individuals. The remaining haplotypes were shared by 2–18 individuals (details are given in the online-only supplementary table). In all cases but one, the chromosomes sharing a haplotype belonged to the same haplogroup (hence, 503 combination haplotypes) and, in most cases, the individuals sharing a haplotype belonged to the same population (table 5).

Online-Only Supplementary Table.

Y-Chromosomal DNA Haplotypes in Pakistani Populations

	Repeat Count at Each Y-STR Locus																No. of Individuals in Populationa
Haplogroup and Haplotype	DYS19	DYS388	DYS389I	DYS389b	DYS390	DYS391	DYS392	DYS393	DYS425	DYS426	DYS434	DYS435	DYS436	DYS437	DYS438	DYS439	BAL	BLT	BRU	BSK	HZR	KAL	KSR	MAKB	MAKN	PRS	PKH	SDH
1:
1	14	12	10	15	25	11	14	12	12	12	9	11	12	9	12	13	2		1
2	14	12	10	16	23	10	10	14	12	12	9	11	12	11	11	10	1
3	14	12	10	16	23	10	14	13	11	12	8	12	12	8	11	11	1
4	14	12	10	16	24	10	10	13	12	12	9	11	12	10	11	12	1
5	14	12	9	15	23	10	10	14	13	11	9	11	12	9	11	11	1
6	14	13	10	17	23	10	10	14	12	12	9	11	12	10	11	10	1							1
7	14	13	9	16	24	10	11	14	12	12	9	11	12	10	11	10	1
8	15	12	10	16	25	10	11	13	12	12	9	11	12	9	12	12	1
9	15	12	11	16	23	11	11	13	12	13	9	11	12	8	12	12	1
10	15	12	9	15	23	11	16	13	13	11	9	11	12	8	12	12	1
11	14	12	11	16	23	10	12	13	12	11	9	11	12	9	11	12		1
12	15	12	12	16	23	10	10	14	12	12	9	11	12	10	11	11		1
13	14	12	10	15	25	10	11	12	12	12	9	11	12	9	12	13			1
14	14	12	10	17	23	10	10	12	12	12	9	11	12	10	11	10			1
15	14	12	9	19	23	11	11	13	14	11	9	11	12	10	11	10			1
16	14	13	10	16	23	10	10	14	12	12	9	11	12	10	11	10			2						2
17	14	15	10	16	22	10	11	12	12	12	9	11	12	10	11	10			1
18	15	13	11	16	24	10	10	14	12	11	9	11	12	10	11	10			1
19	16	12	9	17	25	10	14	13	12	12	9	12	12	8	11	11			1
20	13	12	11	17	22	10	15	13	10	12	9	11	12	9	11	11				1	1
21	13	13	10	16	23	10	15	13	10	12	9	11	12	8	11	11				1
22	14	12	10	15	20	10	13	13	12	12	9	11	12	9	12	13				1
23	14	12	10	16	23	10	12	13	12	11	9	11	12	8	11	11				4
24	14	12	10	16	23	10	12	13	12	11	9	11	12	8	11	12				1
25	14	12	10	16	23	11	12	13	12	11	9	11	12	8	11	11				1
26	14	12	10	16	23	9	12	13	12	11	9	11	12	8	11	11				1
27	14	12	10	17	24	10	10	14	12	12	9	11	12	9	10	10				1
28	14	12	11	16	23	10	12	13	12	11	9	11	10	9	11	11				2
29	15	12	10	15	24	10	10	14	12	12	9	11	12	10	11	11				1
30	15	12	10	16	23	10	12	13	12	11	9	11	12	8	11	11				1
31	15	12	11	15	24	10	10	14	12	12	9	11	12	10	11	11				4
32	15	12	11	15	24	10	10	14	12	12	9	11	12	10	11	12				3
33	15	12	11	15	24	10	10	14	12	12	9	11	12	8	11	12				1
34	15	12	11	16	23	10	12	13	12	11	9	11	12	9	11	11				1
35	15	12	11	16	24	10	10	14	12	12	9	11	12	10	11	13				1
36	16	12	11	16	23	10	10	14	12	12	9	11	12	10	11	11				1
37	13	12	10	16	22	10	15	13	10	12	9	11	12	8	11	11					1
38	14	12	10	17	22	11	13	14	12	12	9	11	12	9	10	12					1
39	14	12	10	17	23	11	13	14	12	12	9	11	12	9	10	12					6
40	14	12	10	17	23	11	14	14	12	12	9	11	12	9	10	12					1
41	14	12	10	18	22	11	13	14	12	12	9	11	12	9	10	12					1
42	14	12	10	18	23	11	13	14	12	12	9	11	12	9	10	12					3
43	14	12	11	16	23	11	12	13	12	11	9	11	12	8	11	12						2
44	14	12	11	16	24	11	12	13	12	11	9	11	12	9	11	12						1
45	14	14	11	16	27	10	11	12	12	11	9	11	12	9	11	12						1
46	14	12	11	17	23	10	10	13	12	12	9	11	12	8	10	11							1
47	14	13	10	16	24	11	13	12	12	12	9	11	12	9	12	12							2
48	13	12	11	17	21	11	14	14	12	11	9	12	12	8	11	11								1
49	14	12	11	16	23	10	10	14	12	12	9	11	12	9	11	10								1
50	14	12	11	16	23	10	10	14	12	12	9	11	12	9	11	11								1
51	14	12	12	15	24	11	14	12	12	12	9	11	12	10	12	12								1
52	14	13	10	15	24	10	10	14	12	12	9	11	12	10	11	10								1
53	13	12	11	16	22	10	15	13	10	12	9	11	12	9	10	11									1
54	14	12	11	15	24	12	10	14	12	12	9	11	12	9	11	10									2
55	14	12	11	16	23	11	10	13	12	12	9	11	12	10	11	10									1
56	14	12	11	15	23	10	10	14	12	12	9	11	12	10	11	12										1
57	14	12	11	15	23	10	10	14	12	12	9	11	12	10	11	13										1
58	14	12	11	16	23	10	10	14	12	12	9	11	12	10	11	12										13
59	14	12	11	16	24	10	10	14	12	12	9	11	12	10	11	12										1
60	14	12	11	17	23	10	10	14	12	12	9	11	12	10	11	12										1
61	15	12	10	16	23	10	10	14	12	12	9	11	12	10	12	10										1
62	15	12	11	16	23	10	10	14	12	12	9	11	12	10	12	10										2
63	15	12	11	16	24	10	14	13	12	12	9	11	12	8	12	11										2
64	15	12	11	16	24	10	14	13	12	12	9	11	12	8	9	11										1
65	15	12	11	16	24	10	15	13	12	12	9	11	12	8	11	11										1
66	13	12	11	16	22	10	14	14	12	11	9	11	12	8	11	13											1
67	13	12	11	19	21	10	14	14	12	12	10	11	12	9	11	12											1
68	14	12	10	16	23	11	13	12	12	12	9	11	12	9	12	14											1
69	14	12	10	17	24	11	12	14	12	12	9	11	12	8	13	12											1
70	14	12	11	16	23	10	14	12	12	12	9	11	12	8	11	13											1
71	14	12	11	18	23	10	12	13	12	12	9	11	12	8	11	12											1
72	14	13	10	16	24	10	13	12	12	12	9	11	12	9	12	12											1
73	15	12	9	16	24	10	14	14	12	12	9	12	12	8	11	11											1
74	16	12	10	16	25	11	15	13	10	12	9	11	12	9	11	13											1
75	16	12	9	18	24	10	14	14	12	11	9	12	12	8	11	12											1
76	13	12	11	16	22	10	15	13	10	12	9	11	12	8	11	12												1
77	14	12	10	15	24	11	14	12	12	12	9	11	12	8	12	14												1
78	14	12	10	16	23	10	10	14	12	12	9	11	12	10	11	10												1
79	14	12	10	16	23	11	11	13	12	12	9	11	12	10	11	11												1
80	14	12	10	18	24	9	14	13	12	12	9	12	12	8	11	12												1
81	14	12	11	16	23	10	16	13	12	12	9	11	12	8	10	11												2
82	14	12	11	16	23	11	10	13	12	12	9	11	12	10	11	11												1
83	14	13	10	15	23	10	10	14	12	12	9	11	12	10	11	10												1
84	15	12	11	16	23	10	10	13	12	12	9	11	12	10	11	10												2
85	15	12	11	16	23	11	10	13	12	12	9	11	12	10	11	10												1
86	15	12	11	16	24	10	10	13	12	12	9	11	12	10	11	14												1
87	15	12	9	16	25	10	14	15	12	12	9	12	12	8	11	12												1
88	15	13	10	17	23	10	10	14	12	12	9	11	12	10	11	10												1
2:
89	17	12	11	16	22	7	11	12	12	11	9	11	12	8	11	11		1
90	14	12	11	18	23	11	12	12	12	12	9	11	12	10	10	11			1
91	14	12	11	18	24	10	12	13	12	11	9	11	11	9	10	11			1
92	14	12	9	17	23	10	12	12	12	11	9	11	12	10	10	12			1
93	14	12	9	17	23	11	12	12	12	11	9	11	12	10	10	11			1
94	14	12	9	19	22	10	11	13	14	11	9	11	12	10	10	11			1
95	14	13	9	17	23	10	10	12	12	11	9	11	12	10	10	11			1
96	15	12	10	17	22	11	11	13	12	11	9	11	12	10	10	11			1
97	15	12	9	17	23	10	11	13	12	11	9	11	12	10	10	11			1
98	15	12	9	18	22	10	11	13	12	11	9	12	12	10	10	11			1
99	15	12	9	19	22	11	11	13	12	11	9	11	12	10	10	11			1
100	17	12	10	17	22	10	11	12	12	13	9	11	12	8	10	12			1
101	14	12	9	16	23	10	11	12	13	11	9	11	12	8	10	11				1
102	15	12	11	16	22	11	11	12	13	11	9	11	12	8	9	11				1
103	15	12	11	16	22	11	11	12	13	11	9	11	12	8	9	12				1
104	15	12	12	13	22	11	11	12	13	11	9	11	12	8	9	12				1
105	15	13	10	17	22	10	11	12	12	11	9	12	12	8	10	12				1
106	15	15	9	16	24	10	11	12	10	11	9	11	12	9	9	11				1
107	16	12	10	17	23	11	11	13	11	11	9	11	11	10	10	11				1
108	14	13	10	16	22	10	12	13	12	11	9	11	12	9	10	11					1
109	14	12	10	16	22	10	14	12	13	11	9	11	12	8	9	11						1
110	14	12	9	16	23	10	15	12	16	11	9	11	12	10	10	11						1
111	15	12	10	16	22	10	11	12	13	11	9	11	12	8	9	11						2
112	15	12	10	16	23	10	11	12	13	11	9	11	12	8	9	11						3
113	15	12	11	16	23	10	11	12	13	11	9	11	12	8	9	11						1
114	15	12	9	16	23	10	11	14	14	11	9	11	12	10	10	11						1
115	15	13	10	16	22	10	11	12	13	11	9	11	12	8	9	11						1
116	15	13	10	16	23	10	11	12	13	11	9	11	12	8	9	11						1
117	16	12	9	16	23	10	11	14	14	11	9	11	12	10	10	11						6
118	14	13	9	17	22	10	12	13	12	11	9	11	12	10	10	12									1
119	15	12	10	18	21	10	11	13	12	11	9	11	12	8	11	11									1
120	15	12	11	14	22	11	11	12	13	11	9	11	12	8	9	13									2
121	14	12	9	17	23	10	12	13	12	11	9	11	12	10	10	13										1
122	15	12	11	16	22	10	11	12	13	11	9	11	12	8	9	11										1
123	17	12	11	16	22	10	11	12	12	11	9	11	12	8	10	12										1
124	14	12	11	16	22	10	11	12	13	11	9	11	12	8	9	10											1
125	14	12	11	17	22	10	11	13	12	11	12	11	12	8	10	12											1
126	15	12	10	16	23	10	11	12	13	11	9	11	12	8	9	13											1
127	15	12	11	19	21	11	11	14	14	11	9	11	12	10	10	11											1
128	16	12	10	15	24	11	11	13	12	11	9	11	12	8	8	11											1
129	16	12	10	17	22	11	11	13	11	11	9	11	11	10	10	12											1
130	16	12	10	17	23	11	11	13	11	11	9	11	11	10	10	12											2
131	16	12	10	17	24	11	11	13	12	11	9	11	11	11	10	11											1
132	16	12	11	17	23	10	11	13	11	11	9	11	11	10	10	11											1
133	16	12	11	18	23	11	11	13	12	12	9	11	11	10	10	11											1
134	16	12	9	17	23	11	11	13	11	11	9	11	11	10	10	12											1
135	16	12	9	18	23	10	11	13	12	11	9	11	11	10	10	11											1
136	17	12	10	17	23	11	11	13	12	11	9	11	11	10	10	11											1
137	16	12	9	17	23	10	12	13	12	11	9	11	12	8	10	14											1
138	14	12	11	16	23	10	11	12	12	12	9	13	12	8	10	10												1
139	14	12	11	16	24	10	11	14	12	11	10	11	11	8	10	12												1
140	14	12	9	17	22	10	12	12	12	11	9	11	12	10	10	12												1
141	15	12	10	16	21	10	11	13	13	11	9	11	12	8	9	11												1
142	15	12	10	17	21	10	11	13	13	11	9	11	12	8	9	11												1
143	15	12	10	18	21	10	11	13	13	11	9	11	12	8	9	11												1
144	15	12	11	17	23	10	10	12	10	11	9	11	12	8	9	12												1
145	15	12	11	18	23	10	11	13	12	10	9	11	13	8	10	10												1
146	15	12	9	18	22	10	11	13	12	11	9	11	12	10	10	11												1
147	16	12	11	14	22	10	11	12	13	11	9	11	12	8	9	11												1
148	18	12	11	14	22	10	11	12	13	11	8	11	12	8	9	11												1
3:
149	15	12	10	17	25	10	11	13	12	12	9	11	12	8	11	10	2
150	15	12	11	15	25	11	11	13	12	12	9	11	12	8	8	11	1
151	15	12	11	16	25	11	11	13	12	12	9	11	12	7	7	11	1
152	15	12	11	17	25	10	11	13	12	12	9	11	12	8	11	10	1											1
153	15	12	11	18	25	10	11	13	12	12	8	11	12	7	10	10	1
154	15	12	11	18	25	10	11	13	12	12	9	11	12	8	11	10	1							1			1	1
155	15	12	11	18	26	10	11	13	12	12	9	11	12	8	11	10	1
156	15	12	11	19	24	10	12	12	12	12	9	11	12	8	11	11	1
157	16	12	10	17	24	11	11	13	12	12	9	11	12	8	11	10	1			1							10	1
158	16	12	10	18	25	10	11	13	12	13	9	11	12	8	11	10	1
159	16	12	10	18	25	11	11	13	12	12	9	11	12	9	11	10	1
160	16	12	9	17	25	11	11	14	12	12	9	11	12	8	11	11	4							1	1			3
161	17	12	10	17	25	10	12	13	12	12	9	11	12	8	11	10	1
162	15	12	9	18	25	10	11	13	12	12	9	11	12	8	11	10		1
163	16	12	10	16	25	11	11	13	12	12	9	11	12	8	11	10		1									1
164	16	12	10	17	24	10	13	13	12	12	9	11	12	8	11	10		1
165	16	12	10	18	25	10	11	13	12	12	9	11	12	8	11	10		2					1			2		1
166	17	12	10	18	25	10	11	13	11	12	9	11	12	8	11	11		1
167	13	12	10	16	25	11	11	13	12	12	9	11	12	8	11	10			1
168	14	10	11	19	24	10	14	12	12	12	9	11	12	8	9	10			1
169	15	12	10	16	25	11	11	13	12	12	9	11	12	8	10	10			1
170	15	12	10	17	23	10	11	12	12	12	9	11	12	8	11	11			1
171	15	12	10	17	24	10	11	12	11	11	9	12	12	8	11	11			1
172	15	12	10	19	24	10	11	12	12	12	9	11	12	8	11	11			1
173	15	12	11	16	24	10	11	12	12	11	9	11	12	8	11	11			1
174	15	12	11	16	25	10	11	13	12	11	9	11	12	8	9	10			1
175	15	12	11	17	24	10	11	12	12	12	9	11	12	8	11	11			1
176	15	12	11	17	25	10	11	12	12	12	9	11	12	8	9	10			1
177	15	12	11	18	24	10	11	12	12	12	9	11	12	8	11	11			18					1
178	15	12	11	18	24	10	11	12	12	12	9	11	12	8	11	12			1
179	15	12	11	18	24	11	11	12	12	12	9	11	12	8	11	11			2
180	15	12	11	18	24	9	11	12	12	12	9	11	12	8	11	11			1
181	15	12	11	18	25	11	11	13	12	12	9	11	12	8	11	12			1
182	15	12	11	18	26	11	11	12	12	12	9	11	12	8	9	10			1
183	15	12	11	19	23	10	11	12	12	12	9	11	12	8	11	11			1
184	15	12	11	19	24	10	11	12	12	12	9	11	12	8	11	11			1
185	15	12	9	16	24	10	11	12	12	12	9	11	12	8	11	11			1
186	15	12	9	17	24	10	11	12	12	12	9	11	12	8	11	11			1
187	15	12	9	18	24	10	11	14	12	12	9	11	12	8	11	10			1
188	16	12	10	17	25	11	11	13	12	12	9	11	12	8	11	11			2
189	16	12	10	18	25	10	11	13	12	12	9	11	12	9	11	10			1					1
190	16	12	11	18	25	11	11	14	12	12	9	11	12	8	9	10			1
191	15	12	10	17	23	10	11	13	12	12	9	10	12	8	11	11				1
192	15	12	10	17	25	11	11	13	12	12	9	12	12	8	9	10				1
193	16	12	10	16	24	10	11	13	12	12	9	11	12	10	9	12				1
194	16	12	10	16	24	10	11	13	12	12	9	11	12	8	11	10				1
195	16	12	10	16	24	11	12	13	12	12	9	11	12	8	11	10				1
196	16	12	10	16	25	10	12	13	12	12	9	11	12	8	11	10				3
197	16	12	10	16	25	10	12	13	12	12	9	11	12	8	11	11				2
198	16	12	10	16	25	11	12	13	12	12	9	11	12	8	11	10				3
199	16	12	10	17	25	11	11	13	12	12	9	11	12	8	11	10				1			4				2	1
200	16	12	10	18	22	10	11	13	12	12	9	11	12	8	11	11				1
201	16	12	10	19	25	11	11	13	12	12	9	11	12	8	11	10				1								1
202	16	12	11	16	25	10	12	13	12	12	9	11	12	8	11	10				2
203	16	12	11	16	26	10	11	13	12	12	9	11	12	8	11	10				1
204	16	12	11	17	23	10	11	13	12	12	9	11	12	8	11	10				1
205	17	12	10	15	25	10	11	13	12	12	9	11	12	8	11	10				3
206	17	12	10	16	25	10	12	13	12	12	9	11	12	8	11	10				1
207	17	12	11	17	24	11	11	13	12	12	9	11	12	8	11	10				1
208	14	12	10	16	23	10	14	12	12	12	9	11	12	8	11	10						1
209	16	12	10	16	23	10	11	14	12	12	9	11	12	8	11	10						1
210	16	12	10	16	24	11	11	13	12	12	9	11	12	8	11	10						1
211	16	13	10	16	24	11	11	13	12	12	9	11	12	8	11	10						1
212	17	12	10	16	24	11	11	13	12	12	9	11	12	8	11	10						3
213	17	12	10	17	25	10	11	13	12	12	9	11	12	8	11	10						1
214	15	12	11	18	25	10	11	13	12	12	9	12	12	8	10	9							1
215	17	12	10	17	25	11	11	13	12	12	9	11	12	8	11	10							1
216	15	12	9	17	26	11	11	14	12	12	9	11	12	8	11	11								1
217	16	12	10	17	23	11	11	13	12	12	9	11	12	8	11	10								1			1
218	16	12	10	18	25	10	11	14	12	12	9	11	12	8	11	11								1
219	13	12	11	15	22	10	15	13	12	11	9	11	12	8	11	11									1
220	15	12	10	17	25	12	8	13	12	12	9	11	12	8	11	10									1
221	15	12	10	18	25	11	11	13	12	12	9	11	12	8	11	11									1
222	15	12	10	18	25	11	11	13	12	12	9	11	12	9	11	10									1
223	15	12	11	16	25	11	11	13	12	12	9	11	12	8	11	10									1
224	15	13	10	17	26	10	11	13	12	12	9	11	12	8	12	11									1
225	16	12	10	18	25	11	11	13	12	12	9	11	12	8	11	10									1			5
226	16	12	10	18	26	10	11	13	12	12	9	11	12	8	11	10									1		1
227	16	12	10	18	26	11	11	13	12	12	9	11	12	8	11	10									1	1
228	15	12	10	16	25	11	11	13	12	12	9	11	12	8	11	10										1
229	16	12	10	17	26	11	11	13	12	12	9	11	12	10	11	10										1
230	16	12	11	18	25	11	11	13	12	12	9	11	12	10	10	11										1
231	16	12	11	18	25	11	11	13	12	12	9	11	12	10	11	10										1
232	15	12	10	17	21	10	11	12	12	12	9	11	12	8	11	10											1
233	15	12	10	17	22	10	15	12	12	12	9	11	12	8	11	10											1
234	15	12	10	17	24	11	11	12	12	12	9	11	12	8	11	10											1
235	15	12	10	17	24	11	11	13	12	12	9	11	12	8	11	10											6
236	15	12	10	17	24	11	11	13	12	12	9	11	12	8	11	11											1
237	15	12	10	17	25	11	11	13	12	12	10	11	12	8	11	10											1
238	15	12	10	17	25	11	11	13	12	12	9	11	12	8	11	10											3
239	15	12	10	18	25	11	11	15	12	12	9	11	12	8	11	10											1
240	15	12	11	16	24	11	11	13	12	12	9	11	12	8	11	10											1
241	16	12	10	16	24	11	11	13	12	12	9	11	12	8	11	11											1
242	16	12	10	17	24	11	11	13	12	11	9	11	12	8	11	10											1
243	16	12	10	17	24	11	11	14	12	12	9	11	12	8	11	10											1
244	16	12	10	17	24	12	11	13	12	12	9	11	12	8	11	10											1
245	16	12	10	18	24	10	11	13	12	12	9	11	12	8	11	10											2
246	16	12	11	17	24	10	11	13	12	12	9	11	12	8	11	10											1
247	16	12	11	17	24	11	11	14	12	12	9	11	12	8	11	10											1
248	16	12	11	18	24	11	11	13	12	12	9	11	12	8	11	10											1
249	16	12	9	16	24	12	11	13	12	12	9	11	12	8	11	10											1
250	14	12	11	18	23	10	11	12	12	12	9	11	12	8	11	10												1
251	15	12	10	17	25	10	11	13	12	12	9	12	12	8	9	10												1
252	15	12	10	18	25	10	11	13	12	12	9	11	12	8	9	10												1
253	15	12	10	18	25	10	11	13	13	12	9	11	12	8	11	10												1
254	15	12	10	18	25	11	11	13	12	13	9	11	12	8	11	10												2
255	15	12	10	19	25	11	11	13	12	12	9	11	12	8	11	9												1
256	15	12	11	16	24	11	11	13	12	12	9	11	12	8	12	11												1
257	15	12	11	17	25	11	11	13	12	12	9	11	12	8	11	11												1
258	15	12	11	17	25	11	12	13	12	12	9	11	12	9	11	10												1
259	15	12	11	18	24	10	11	13	12	12	9	11	12	8	11	10												2
260	15	12	11	18	25	10	11	13	12	12	9	11	12	8	9	10												1
261	15	12	11	18	25	11	11	13	12	12	9	11	12	8	9	10												1
262	15	13	9	17	25	11	11	13	12	12	9	11	12	8	11	11												2
263	16	12	10	17	25	12	11	13	12	12	9	11	12	8	10	9												1
264	16	12	10	17	26	11	11	13	12	11	9	11	12	8	11	10												1
265	16	12	10	18	24	11	11	13	12	12	9	11	12	8	11	10												1
266	16	12	10	18	24	11	11	13	12	12	9	11	12	8	11	11												1
267	16	12	10	18	25	11	11	13	12	12	9	11	12	8	11	11												2
268	16	12	10	18	25	11	11	13	12	12	9	12	12	9	11	10												1
269	16	12	10	18	25	11	11	13	12	13	9	11	12	8	11	10												6
270	16	12	10	18	25	11	11	14	12	12	9	11	12	8	11	11												1
271	16	12	10	19	25	11	11	13	12	13	9	11	12	8	11	10												1
272	16	12	11	16	24	11	11	13	12	12	9	11	12	8	11	10												1
273	16	12	11	17	25	11	11	13	12	12	9	11	12	8	9	10												1
274	16	12	11	18	24	10	11	13	12	12	9	11	12	8	11	10												1
275	16	12	11	18	25	10	11	13	12	12	9	11	12	8	11	10												1
276	16	12	11	18	25	10	12	13	12	12	9	11	12	9	11	10												1
277	16	12	11	18	25	11	11	13	12	10	9	11	12	8	11	10												1
278	16	12	11	18	25	11	11	13	12	12	9	11	12	8	11	10												1
279	16	12	9	17	25	11	11	13	12	12	9	11	12	8	11	10												1
280	17	12	10	17	24	10	11	13	12	12	9	11	12	8	11	10												1
281	17	12	10	18	23	10	12	13	12	12	9	11	12	8	11	10												1
282	17	12	10	18	24	10	12	13	12	12	9	11	12	8	11	10												2
283	17	12	10	18	25	10	12	13	12	12	9	11	12	8	11	10												1
284	17	12	10	18	25	11	11	13	12	12	9	11	12	8	11	10												1
285	17	12	10	18	25	11	11	13	12	12	9	11	12	9	11	10												1
8:
286	17	12	10	17	21	10	11	14	10	11	10	11	12	8	11	11	1
287	15	12	10	18	21	10	11	13	12	11	9	11	12	8	12	12			1
288	15	12	11	17	21	10	11	14	12	11	9	11	12	8	11	12			1
289	15	12	10	17	21	11	11	13	12	11	9	11	12	8	11	12			1
290	15	12	10	18	21	11	11	13	12	11	9	11	12	8	11	12								1
291	15	12	10	17	21	10	11	13	12	11	9	11	12	8	11	11									1
292	15	12	10	18	21	9	11	13	12	11	9	11	12	8	12	12									1
293	17	12	9	17	21	10	11	14	10	11	10	11	12	8	11	11									1
9:
294	14	14	11	16	23	10	11	12	12	11	9	11	12	8	9	12	1		1			2		1
295	14	15	10	16	23	10	11	12	12	11	9	11	12	9	9	11	1
296	14	15	10	17	22	10	11	12	12	11	9	11	12	9	10	11	1
297	14	15	10	17	23	10	11	12	12	11	9	11	12	10	9	12	1
298	14	15	11	16	24	10	11	12	12	11	9	11	12	10	11	11	1
299	14	16	10	16	23	10	10	13	12	11	9	11	12	8	9	11	1
300	14	16	10	17	23	10	11	12	12	11	9	11	12	8	10	11	1
301	14	15	10	16	25	11	11	12	12	11	9	11	12	8	11	10		1
302	15	16	10	16	24	10	11	12	12	11	9	11	12	10	9	12		1
303	13	15	9	16	23	10	11	12	12	11	9	11	13	8	9	12			1
304	14	13	10	17	23	10	10	14	12	11	9	11	12	8	9	13			1
305	14	14	10	16	22	10	11	12	10	11	9	11	12	8	10	12			2
306	14	14	10	16	22	10	11	12	12	11	9	11	12	8	10	12			2
307	14	15	10	16	22	10	11	12	10	11	9	11	12	8	10	12			1
308	14	15	10	16	22	10	11	12	12	11	9	11	12	8	10	12			2
309	14	15	10	16	22	10	11	12	13	11	9	11	12	8	10	12			1
310	14	15	10	16	22	10	11	12	9	11	9	11	12	8	10	12			1
311	14	15	10	16	22	10	11	12	9	11	9	12	12	8	11	13			1
312	14	15	10	16	22	10	11	13	12	11	9	11	12	9	9	11			1
313	14	15	10	17	22	10	11	10	12	11	9	11	12	9	9	11			1
314	14	15	11	17	22	10	11	12	12	11	9	11	12	8	10	12			2
315	14	15	11	18	22	9	11	12	12	11	10	11	12	8	9	11			1
316	14	15	9	17	22	10	11	12	12	12	9	11	12	8	11	12			1
317	14	16	10	16	24	10	11	12	13	11	9	11	12	8	10	11			1
318	14	16	10	17	23	10	11	12	12	12	9	11	12	8	10	11			1
319	14	16	10	17	23	12	11	12	12	11	9	11	12	8	10	11			1
320	14	16	10	17	24	10	11	12	12	11	9	11	12	8	10	12			1
321	14	16	10	17	24	10	11	12	12	11	9	11	12	9	9	12			1
322	14	16	11	17	23	10	11	12	12	11	9	11	12	8	10	11			2					1
323	14	16	9	16	23	10	11	12	12	11	9	11	12	8	10	11			1
324	14	17	10	18	23	10	11	12	12	11	9	10	13	8	10	11			1
325	15	12	10	16	25	11	11	13	12	11	9	11	12	8	10	12			1
326	15	15	10	16	24	10	11	12	12	11	9	11	12	9	9	12			1
327	15	16	10	16	23	10	11	12	12	11	9	11	12	8	9	11			1
328	14	14	10	16	24	10	11	12	13	11	9	11	12	9	10	11				2
329	14	15	10	17	23	10	11	12	12	11	9	11	12	9	9	11				1
330	15	15	12	16	23	10	11	12	12	11	9	11	12	8	9	11				1
331	15	15	9	16	24	10	11	12	10	11	9	11	12	9	9	11				1
332	15	15	9	16	24	10	11	12	12	11	9	11	12	9	9	11				2
333	15	15	11	16	23	10	11	14	12	11	10	11	12	9	9	11					1
334	15	15	9	17	23	9	11	12	14	11	9	11	12	9	9	13						1
335	17	13	11	16	24	11	11	13	12	11	9	11	12	8	9	12						1
336	14	14	10	17	23	10	11	12	12	11	9	11	12	9	9	12							1
337	14	14	9	19	23	9	11	12	12	11	9	11	12	8	9	14							1
338	14	15	11	16	23	10	11	13	12	11	9	11	12	9	9	11								1				3
339	15	14	10	16	24	10	11	12	12	11	9	11	12	8	9	12								1
340	15	15	10	15	24	10	11	14	12	11	9	11	12	9	9	10								2
341	14	12	12	17	23	10	11	13	12	11	9	11	12	9	9	12									1
342	14	13	9	16	23	10	10	14	12	12	9	11	12	9	9	12									1
343	14	14	10	16	25	10	11	12	13	11	9	11	12	9	9	13									1
344	14	15	10	18	23	10	11	13	12	11	9	11	12	9	9	11									1
345	14	15	11	16	23	10	11	12	12	11	9	11	12	9	9	11									1
346	14	15	9	16	24	11	12	13	12	12	9	11	12	9	9	13									1
347	14	14	10	17	23	10	11	12	12	11	9	11	12	9	9	13										1
348	14	15	10	16	23	10	11	12	12	11	10	11	12	9	9	12										1
349	14	15	10	16	23	10	11	12	12	11	9	11	12	9	9	13										1
350	14	15	10	16	24	10	11	12	12	11	10	11	12	9	9	12										2
351	14	15	10	16	24	10	11	12	12	11	9	11	12	10	10	11										1
352	14	15	10	19	23	10	11	13	12	11	9	11	12	8	10	12										1
353	14	15	11	16	24	10	11	12	12	11	10	11	12	9	9	12										1
354	14	15	11	17	23	9	11	12	12	11	9	11	12	9	9	11										1
355	14	15	11	17	26	10	10	13	12	11	9	12	12	9	9	11										1
356	14	15	11	18	25	10	11	13	12	11	8	11	12	10	10	12										1
357	14	15	11	18	26	10	11	13	12	11	8	11	12	10	10	11										1
358	14	15	11	18	26	10	11	13	12	11	8	11	12	10	10	12										1
359	14	15	11	18	26	10	11	14	12	11	8	11	12	10	10	12										1
360	14	16	10	16	24	10	11	12	12	11	10	11	12	9	9	12										1
361	14	18	10	16	23	10	11	12	12	11	9	12	12	9	9	11										2
362	15	15	10	16	23	10	11	12	12	11	10	11	12	9	9	12										1
363	15	15	10	16	23	10	11	12	12	11	9	11	12	10	9	12										3
364	15	15	10	16	23	10	11	12	12	11	9	11	12	10	9	13										2
365	15	15	10	16	23	10	12	12	12	11	9	11	12	10	9	13										1
366	15	15	10	16	24	10	11	12	12	11	9	11	12	10	9	13										1
367	15	15	10	17	23	10	11	12	12	11	9	11	12	10	9	12										1
368	15	15	9	14	25	10	11	12	12	11	8	11	12	9	9	11										1
369	15	15	9	17	23	10	11	12	12	11	9	11	12	10	9	13										1
370	15	16	10	17	23	11	11	12	12	11	9	11	12	8	9	10										1
371	15	16	9	14	25	10	11	12	12	11	8	11	12	9	9	11										4
372	16	15	10	16	24	10	11	12	12	11	9	11	12	9	9	12										2
373	14	14	10	17	24	10	11	12	13	11	7	11	12	9	9	13											1
374	14	15	10	18	23	10	11	10	12	11	9	11	12	9	9	11											1
375	14	15	11	18	24	9	11	13	12	12	9	11	12	8	10	12											1
376	15	15	11	18	23	10	11	12	12	12	9	11	12	9	9	11											1
377	15	16	9	16	24	10	11	12	12	11	9	11	12	9	9	11											1
378	16	12	10	17	23	11	11	13	11	11	9	11	11	10	10	12											1
379	13	15	10	15	23	10	11	12	12	11	9	11	12	8	9	12												1
380	14	13	10	16	23	10	11	12	12	11	9	12	11	8	10	11												1
381	14	13	9	15	23	10	11	12	12	11	9	12	11	8	10	11												1
382	14	14	11	16	23	10	11	12	10	11	9	11	12	8	9	12												1
383	14	14	11	16	23	10	11	13	12	11	9	11	12	8	9	12												1
384	14	14	11	17	24	10	11	12	10	11	9	11	12	8	9	11												1
385	14	15	10	16	24	10	11	13	12	11	9	11	12	8	9	11												1
386	14	15	10	17	22	9	11	12	12	11	9	11	12	10	10	13												1
387	14	16	10	18	23	10	11	13	12	11	9	11	12	8	10	11												1
388	14	17	10	19	23	10	11	13	10	11	9	11	12	8	10	11												1
389	15	15	10	16	23	11	11	12	12	11	9	11	12	9	9	11												1
390	15	15	10	17	23	10	11	12	12	11	9	11	12	8	11	10												1
391	15	15	11	17	23	11	11	13	10	11	9	11	12	8	9	12												1
392	15	15	11	17	23	11	11	13	10	11	9	11	12	8	9	13												1
393	15	15	11	17	24	11	11	13	14	11	9	11	12	8	9	13												1
394	15	15	9	16	22	10	11	12	12	11	9	11	12	9	9	12												1
395	15	15	9	16	24	10	11	13	13	11	9	11	12	9	9	12												1
396	15	15	9	17	24	11	11	13	13	11	9	11	12	9	9	13												1
397	16	15	11	16	23	10	11	12	12	11	9	12	12	8	9	13												1
398	16	15	9	16	23	9	12	12	12	11	9	11	12	9	10	12												1
399	16	15	9	16	23	9	12	12	12	12	9	11	12	9	10	12												1
400	16	15	9	17	24	10	11	12	12	11	9	11	12	9	9	11												1
10:
401	15	13	10	15	25	10	11	14	12	11	11	11	12	8	11	11			1
402	15	13	10	16	25	10	11	14	12	11	11	11	12	8	11	12			1
403	15	13	10	17	23	10	11	15	12	11	11	11	12	8	10	12				1
404	15	13	11	16	22	9	11	14	12	11	11	11	12	8	10	11				5
405	16	13	10	15	22	9	11	14	12	11	11	11	12	8	11	11				1
406	16	13	11	16	22	9	11	14	12	11	11	11	12	8	10	11				1
407	16	14	10	16	25	10	11	13	12	11	11	11	12	8	10	10					4
408	16	14	10	17	25	10	11	13	12	11	11	11	12	8	10	10					3
12:
409	15	12	11	16	25	10	15	14	12	11	8	12	12	8	10	13			1
13:
410	17	12	9	15	25	11	13	12	11	11	9	12	12	8	10	11			1
21:
411	13	12	11	17	23	9	11	14	10	11	9	11	12	8	10	12	1
412	14	12	10	17	24	10	10	13	10	11	9	11	12	8	10	12	1
413	14	12	10	17	24	10	12	13	10	11	9	11	12	8	10	13	1
414	14	12	10	17	24	10	12	13	12	11	9	11	12	8	10	12	1
415	15	12	10	17	24	10	11	13	10	11	9	11	13	8	10	12	1
416	13	12	9	19	24	10	11	13	13	11	9	11	12	8	10	12								1
417	17	12	9	17	21	10	11	14	10	11	10	11	12	8	11	11									1
418	13	12	10	19	24	10	11	13	10	11	9	11	12	8	10	12										1
419	13	12	10	19	24	11	11	13	10	11	9	11	12	8	10	12										1
420	13	12	11	17	24	11	11	12	12	11	9	11	12	8	10	12										1
421	13	12	9	19	24	10	11	13	10	11	9	11	12	9	9	13										1
422	15	12	11	17	24	9	11	13	10	11	9	11	12	8	10	11										1
423	13	12	10	17	24	10	11	13	10	11	9	11	11	8	10	12											1
424	13	12	10	17	24	10	11	13	10	11	9	11	12	8	10	12											1
425	13	12	10	18	22	10	11	13	12	12	9	11	12	8	10	12												1
426	13	12	9	17	22	10	11	13	12	11	9	11	12	8	10	13												1
427	13	12	9	17	22	10	11	13	12	12	9	11	12	8	10	12												1
26:
428	15	12	9	18	21	10	11	15	15	10	9	11	12	10	10	12	1
429	14	13	9	17	23	10	10	14	12	11	9	11	12	9	11	12			1
430	16	12	10	16	22	10	14	12	13	11	9	11	12	10	10	12				1
431	16	12	9	17	23	10	12	12	12	11	9	11	12	9	10	13				3
432	14	10	9	16	23	10	14	12	12	11	9	11	12	9	11	12											1
433	14	12	10	17	23	10	12	13	12	11	9	11	12	8	9	11											1
434	15	12	9	16	22	10	14	12	11	11	9	11	12	8	10	12											1
435	15	12	9	16	25	10	13	14	11	11	9	11	12	8	10	12											2
436	15	12	9	17	25	10	13	14	11	11	9	11	12	8	11	10											1
28:
437	14	12	10	14	22	10	12	11	13	11	9	11	12	9	10	13	1
438	14	12	9	15	22	10	13	11	13	11	10	11	12	9	10	11	4
439	14	12	9	15	22	10	15	11	13	11	10	11	12	9	10	11	1
440	14	12	9	16	22	10	14	11	13	11	10	11	12	8	11	12	1
441	14	12	9	16	22	10	14	11	13	11	9	11	12	10	11	13	1
442	14	12	9	16	22	10	14	11	13	11	9	11	12	9	10	13	4							1				2
443	14	12	9	16	22	10	14	11	13	11	9	11	12	9	11	12	1
444	14	12	9	16	22	11	14	11	13	11	9	11	12	9	10	14	1
445	15	12	10	16	22	10	14	12	13	11	9	11	12	10	10	12	1			1
446	15	12	10	16	22	10	14	12	13	11	9	11	12	10	10	13	1
447	15	12	10	16	23	10	14	12	13	11	9	11	12	10	10	12	1
448	15	12	10	16	22	11	15	13	13	11	9	11	13	10	10	13		1
449	15	12	10	17	22	10	15	13	13	11	9	11	13	10	10	13		1
450	13	12	9	16	25	11	11	13	13	11	9	11	12	9	10	13			1
451	14	12	11	18	22	10	14	11	12	12	9	11	12	9	10	13			1
452	14	12	9	15	22	10	14	11	13	11	10	11	12	9	10	11			1						1
453	14	12	9	16	22	10	11	12	13	11	9	11	12	9	10	13			1
454	14	12	9	16	22	10	14	11	13	11	9	11	12	9	10	11			1
455	14	12	9	16	23	10	10	15	13	11	9	11	12	9	10	13			1
456	15	12	10	16	23	10	14	12	13	11	9	11	12	10	9	13			1
457	15	12	10	17	23	10	14	12	12	12	9	11	12	10	10	13			1
458	15	12	10	16	22	10	14	12	13	11	9	11	12	10	10	11				1
459	15	12	10	16	22	10	14	12	13	11	9	12	12	10	10	13				3
460	15	13	10	16	22	10	14	12	13	11	9	11	12	10	10	11				2
461	16	12	10	16	22	10	14	12	13	11	9	11	12	10	10	12				4
462	16	12	10	16	22	10	14	12	13	11	9	11	12	10	11	12				1
463	16	12	11	16	22	10	14	12	13	11	9	11	12	10	10	12				1
464	16	12	11	16	23	10	15	13	13	11	9	11	12	10	10	12				1
465	17	12	11	16	22	10	14	12	13	11	9	11	12	10	10	12				1
466	17	12	11	16	22	11	14	12	13	11	9	11	12	10	9	12				1
467	14	12	11	16	22	10	15	12	13	11	9	11	12	10	10	12						7
468	14	12	11	16	23	10	11	13	13	11	9	11	12	10	10	11						1
469	14	12	12	16	22	10	14	12	13	11	9	11	12	10	10	11						1
470	15	12	11	16	23	10	11	12	13	11	9	11	13	10	10	12						1
471	16	13	11	16	24	11	11	13	13	11	9	11	12	10	10	11						1
472	14	12	10	16	22	10	14	11	13	11	9	11	12	9	11	13								1
473	15	12	10	17	24	10	14	11	13	11	9	11	12	10	10	12								1
474	15	12	11	16	24	10	15	11	13	11	9	11	12	9	10	12								1
475	15	12	9	16	22	10	14	11	13	11	9	11	12	9	11	13									1
476	15	13	11	15	22	10	14	12	13	11	9	11	12	10	10	11									1
477	14	12	10	15	22	10	14	11	13	11	9	11	12	9	10	11										1
478	15	12	10	17	23	10	13	10	10	10	9	11	11	10	10	11										1
479	15	12	10	17	23	10	13	10	10	10	9	11	12	10	10	11										1
480	15	12	11	17	23	10	12	14	10	10	9	11	12	10	10	11										1
481	15	12	11	17	23	10	13	10	10	10	9	11	12	10	10	11										5
482	15	12	11	17	23	10	13	10	10	10	9	11	12	10	11	11										1
483	15	12	11	17	23	10	13	10	10	10	9	11	12	10	11	12										1
484	15	12	11	17	23	10	13	10	10	11	9	11	12	10	10	11										2
485	15	12	11	17	23	11	13	10	10	10	9	11	12	10	10	11										2
486	15	12	11	17	29	10	13	10	10	10	9	11	12	10	10	11										1
487	13	12	10	16	22	10	14	12	13	11	9	11	12	10	10	13											1
488	14	12	9	15	22	10	14	11	13	11	9	11	12	9	10	12											1
489	14	12	9	16	23	10	14	11	13	11	9	11	12	9	10	12											1
490	14	12	9	17	21	10	16	11	13	11	9	11	12	9	10	11											1
491	15	12	10	16	22	10	14	12	13	11	10	12	12	10	10	12											1
492	15	12	10	16	22	10	14	12	13	11	10	12	12	10	10	13											1
493	15	12	10	16	22	10	14	12	13	11	9	11	12	10	11	12											2
494	15	12	11	16	22	10	14	12	12	12	9	11	12	10	10	13											1
495	15	12	9	16	22	10	14	12	13	11	9	11	12	9	10	12											1
496	16	12	10	16	22	10	14	12	13	11	10	11	12	10	10	13											1
497	16	13	9	16	22	11	13	12	12	11	9	11	12	9	11	14											1
498	14	12	9	16	22	10	14	11	13	11	9	11	12	9	10	12												1
499	14	12	9	17	22	10	11	13	13	11	9	11	12	9	11	12												1
500	15	12	10	15	22	10	14	13	13	11	9	11	13	10	10	13												1
501	15	12	10	16	22	10	14	12	13	11	9	12	12	10	11	12												1
502	15	12	10	16	22	10	14	12	13	11	9	12	12	9	10	13												1
503	16	12	9	16	22	10	14	12	13	11	9	12	12	10	10	12												1

^aPopulation codes are as defined in table 1.

Table 5.

Y-STR Haplotypes, Found in Five or More Individuals, and Their Haplogroup Designation

DYS19; DYS388; DYS389I; DYS389b; DYS390; DYS391;DYS392; DYS393; DYS425; DYS426; DYS434; DYS437;DYS435; DYS438; DYS436; DYS439	Haplogroup	Population (No. of Individuals)a
14_12_10_17_23_11_13_14_12_12_9_9_11_10_12_12	1	HZR (6)
14_12_11_16_23_10_10_14_12_12_9_10_11_11_12_12	1	PRS (13)
16_12_9_16_23_10_11_14_14_11_9_10_11_10_12_11	2	KAL (6)
15_12_10_17_24_11_11_13_12_12_9_8_11_11_12_10	3	PKH (6)
15_12_11_18_24_10_11_12_12_12_9_8_11_11_12_11	3	BRU (18) MAKB (1)
16_12_9_17_25_11_11_14_12_12_9_8_11_11_12_11	3	BAL (4); MAKB (1); MAKN (1); SDH (3)
16_12_10_17_24_11_11_13_12_12_9_8_11_11_12_10	3	BAL (1); BSK (1); PKH (10); SDH (1)
16_12_10_17_25_11_11_13_12_12_9_8_11_11_12_10	3	BSK (1); KSR (4); PKH (2); SDH (1)
16_12_10_18_25_10_11_13_12_12_9_8_11_11_12_10	3	BLT (2); KSR (1); PRS (2); SDH (1)
16_12_10_18_25_11_11_13_12_12_9_8_11_11_12_10	3	MAKN (1); SDH (5)
16_12_10_18_25_11_11_13_12_13_9_8_11_11_12_10	3	SDH (6)
14_14_11_16_23_10_11_12_12_11_9_8_11_9_12_12	9	BAL (1); BRU (1); KAL (2); MAKB (1)
15_13_11_16_22_9_11_14_12_11_11_8_11_10_12_11	10	BSK (5)
16_12_10_16_22_10_14_12_13_11_9_10_11_10_12_12	26/28	BSK (5)
14_12_9_16_22_10_14_11_13_11_9_9_11_10_12_13	28	BAL (4); MAKB (1); SDH (2)
14_12_11_16_22_10_15_12_13_11_9_10_11_10_12_12	28	KAL (7)
15_12_11_17_23_10_13_10_10_10_9_10_11_10_12_11	28	PRS (5)

^aPopulation codes are as defined in figure 1.

The G_ST and modal size of the repeat unit, for all 16 Y-STRs examined in the Pakistani population, are given in table 6. The correlation between marker heterozygosity and G_ST was found not to be significant (r=0.329; P=.213). The modal size and variance of the 16 Y-STRs within haplogroups 1, 2, 3, 8, 9, 10, 21, 26, and 28 is also given in table 6. Certain haplogroups have a different modal allele size, and some examples of this are shown in boldface italics in table 6. For instance, DYS388 has 15 repeats in haplogroup 9, compared with 12 repeats in most of the other haplogroups in Pakistan. Similarly, the modal allele for DYS438 is 9 in haplogroup 9, but 10 or 11 in the other haplogroups. The modal allele for DYS434 for haplogroup 10 is 11, which is strikingly different from the allele size of this locus in other haplogroups. The complete lack of variability for DYS436 in the 233 male subjects belonging to haplogroup 3 is notable. Haplogroup 10 appears to have the least variability across most loci except for DYS390 (table 6). These findings demonstrate the strong structuring of Y-STR variability by haplogroup.

Table 6.

Modal Allele ± Variance and G_ST of the 16 Y-STRs within Each Haplogroup and in the Pakistani Population

		Modal Allele ± Variance in
		Haplogroup
Y-STR	GST	1a	2b	3c	8d	9e	10f	21g	26h	28i	Pakistanj
DYS19	.073	14 ± .4	15 ± .8	16 ± .5	15 ± .9	14 ± .4	16 ± .3	13 ± 1.2	15 ± .6	15 ± .6	15 ± .9
DYS388	.056	12 ± .2	12 ± .2	12 ± .0	12 ± .0	15 ± .9	13 ± .3	12 ± .0	12 ± .4	12 ± .0	12 ± 1.5
DYS389I	.089	11 ± .4	10 ± .7	10 ± .3	10 ± .3	10 ± .5	10 ± .2	10 ± .5	9 ± .2	10 ± .7	10 ± .5
DYS389b	.117	16 ± .7	16 ± 1.3	18 ± .7	17 ± .3	16 ± .8	16 ± .4	17 ± .8	17 ± .4	16 ± .4	16 ± 1.0
DYS390	.085	23 ± .7	23 ± .5	25 ± .6	21 ± .0	23 ± .8	25 ± 2.2	24 ± 1.0	23 ± 1.6	22 ± .8	23 ± 1.4
DYS391	.085	10 ± .3	10 ± .4	11 ± .3	10 ± .4	10 ± .2	10 ± .3	10 ± .3	10 ± .0	10 ± .1	10 ± .3
DYS392	.090	10 ± 3.5	11 ± .5	11 ± .3	11 ± .0	11 ± .1	11 ± .0	11 ± .2	12 ± 1.5	14 ± 1.1	11 ± 1.8
DYS393	. 131	14 ± .5	12 ± .5	13 ± .3	13 ± .3	12 ± .4	14 ± .4	13 ± .2	12 ± 1.3	12 ± .9	13 ± .8
DYS425	.095	12 ± .3	12 ± 1.0	12 ± .0	12 ± .7	12 ± .5	12 ± .0	10 ± 1.2	12 ± 1.3	13 ± 1.2	12 ± .6
DYS426	.088	12 ± .2	11 ± .1	12 ± .1	11 ± .0	11 ± .1	11 ± .0	11 ± .1	11 ± .1	11 ± .2	11 ± .3
DYS434	.124	9 ± .0	9 ± .2	9 ± .0	9 ± .2	9 ± .2	11 ± .0	9 ± .1	9 ± .0	9 ± .1	9 ± .2
DYS437	.126	10 ± .7	8 ± 1.0	8 ± .1	8 ± .0	9 ± .5	8 ± .0	8 ± .1	9 ± .6	10 ± .3	8 ± .7
DYS435	.028	11 ± .1	11 ± .1	11 ± .0	11 ± .0	11 ± .1	11 ± .0	11 ± .0	11 ± .0	11 ± .1	11 ± .1
DYS438	.119	11 ± .3	10 ± .3	11 ± .3	11 ± .2	9 ± .3	10 ± .2	10 ± .1	10 ± .3	10 ± .1	11 ± .7
DYS436	.074	12 ± .1	12 ± .2	12 ± .0	12 ± .0	12 ± .0	12 ± .0	12 ± .1	12 ± .0	12 ± .1	12 ± .1
DYS439	.067	12 ± 1.0	11 ± .5	10 ± .3	12 ± .7	12 ± .6	11 ± .5	12 ± .3	12 ± .7	12 ± .7	11 ± 1.0

^aTotal number of Y-STR haplotypes found = 88; number of chromosomes found = 130.

^bTotal number of Y-STR haplotypes found = 60; number of chromosomes found = 70.

^cTotal number of Y-STR haplotypes found = 137; number of chromosomes found = 233.

^dTotal number of Y-STR haplotypes found = 8; number of chromosomes found = 8.

^eTotal number of Y-STR haplotypes found = 107; number of chromosomes found = 132.

^fTotal number of Y-STR haplotypes found = 8; number of chromosomes found = 17.

^gTotal number of Y-STR haplotypes found = 17; number of chromosomes found = 17.

^hTotal number of Y-STR haplotypes found = 9; number of chromosomes found = 12.

ⁱTotal number of Y-STR haplotypes found = 67; number of chromosomes found = 97.

^jTotal number of Y-STR haplotypes found = 503; number of chromosomes found = 718 (includes one individual from each of haplogroups 12 and 13).

We wanted to calculate a Y-based measure of genetic distance between populations that would reflect the differentiation that had occurred within Pakistan and that would not be disproportionately dominated by ancient differences that had previously accumulated between haplogroups. The standard way to do this would be to use STR variation, and table 7 summarizes population pairwise values of Φ_ST on the basis of STR variation alone (A) or of binary-marker plus STR variation (B), with binary-marker differences weighted 10 times higher than STR differences. These matrices are highly correlated (r=0.95; P<.001), as might be expected from the structuring of STR variation by haplogroup. However, these measures are significantly influenced by ancient differences, and we have therefore developed a modified measure. We reasoned that much of the STR variation within haplogroups would have originated recently and could be used for this purpose. We therefore calculated population pairwise values of Φ_ST, on the basis of STR variation within haplogroups, and used a weighted average of these to produce a single Φ_ST distance matrix (table 7C; fig. 3). These distances are also highly correlated with distances based on STRs alone (r=0.76; P<.001) or on STRs plus binary markers (r=0.70; P<.001), but a greater proportion of the variation is seen between populations (22%, compared with 6% and 7%, respectively). A comparison of figure 3 with figure 2B (which was based on binary marker frequencies alone) reveals a striking overall resemblance, with the Hazaras being distinct from all of the other populations. The other outstanding populations are the Kalash and Parsis (as before), the Kashmiris (perhaps because of the small sample), and the Brahuis, who are thus more distinct in their STR profiles than haplogroup frequencies. MDS plots of the distances in tables 7A and 7B (not shown) lead to similar conclusions, but resemble figure 2B more closely in the way that the Brahuis do not stand out so much.

Table 7.

Population Pairwise Φ_ST Values Based on STR Variation Alone, Combined Binary Marker and STR Variation, or Weighted Within-Haplogroup STR Variation

	Population Pairwise ΦST Values Based on STR Variation Alone
Population	Baluch	Balti	Brahui	Burusho	Hazara	Kalash	Kashmiri	Makrani Baluch	Makrani Negroid	Parsi	Pathan
Balti	.027
Brahui	.053	.055
Burusho	.036	.012	.084
Hazara	.092	.124	.158	.126
Kalash	.063	.104	.120	.049	.195
Kashmiri	.084	.006	.083	.114	.142	.216
Makrani Baluch	.004	.007	.021	.032	.080	.078	.053
Makrani Negroid	.013	.001	.043	.033	.091	.088	.044	−.011
Parsi	.078	.092	.076	.091	.142	.107	.154	.052	.074
Pathan	.049	.001	.078	.054	.113	.126	.026	.032	.034	.135
Sindhi	.065	−.010	.054	.069	.129	.14	−.002	.027	.021	.122	.024
	Population Pairwise ΦST Values Based on Combined Binary Marker and STR Variation
	Baluch	Balti	Brahui	Burusho	Hazara	Kalash	Kashmiri	Makrani Baluch	Makrani Negroid	Parsi	Pathan
Balti	.005
Brahui	.048	.017
Burusho	.021	−.010	.058
Hazara	.107	.134	.129	.095
Kalash	.052	.095	.078	.060	.159
Kashmiri	.088	−.020	.072	.087	.201	.234
Makrani Baluch	−.005	−.020	.003	.015	.083	.052	.056
Makrani Negroid	.014	.000	.013	.031	.086	.055	.065	−.020
Parsi	.078	.101	.061	.100	.132	.066	.198	.037	.053
Pathan	.033	−.020	.050	.028	.133	.108	.025	.021	.031	.140
Sindhi	.057	−.020	.028	.050	.141	.126	−.001	.017	.023	.125	.014
	Population Pairwise ΦST Values Based on Weighted Within-Haplogroup STR Variation
	Baluch	Balti	Brahui	Burusho	Hazara	Kalash	Kashmiri	Makrani Baluch	Makrani Negroid	Parsi	Pathan
Balti	.164
Brahui	.174	.311
Burusho	.212	.127	.348
Hazara	.454	.653	.545	.520
Kalash	.337	.305	.351	.233	.642
Kashmiri	.173	.143	.426	.271	.483	.455
Makrani Baluch	.004	.094	.151	.208	.463	.344	.173
Makrani Negroid	.035	.091	.239	.167	.516	.271	.156	.008
Parsi	.285	.173	.260	.283	.558	.402	.330	.169	.175
Pathan	.174	.261	.361	.203	.490	.248	.226	.211	.158	.346
Sindhi	.059	.039	.268	.129	.503	.195	.073	.054	.017	.117	.140

Figure 3.

Multidimensional scaling presentation of weighted population pairwise values of Φ_ST. RSQ value = 0.81. Linguistic affiliations of populations are indicated as in figure 2B.

Median-Joining Networks

The genetic relationships among the different Pakistani ethnic groups were explored further by drawing median-joining networks (Bandelt et al. 1995), and examples are shown in figures 4, 5, and 6. The haplogroup 1 network (fig. 4) reveals considerable variation, but also a high degree of population-specific substructure. For example, the 24 Parsi haplogroup 1 chromosomes all fall into one of three clusters (fig. 4, green), 19 of 26 Burusho haplogroup 1 chromosomes fall into two clusters (blue), and 12 of 14 Hazara haplogroup 1 chromosomes fall into a single cluster, and all of these clusters are specific to their respective populations. The haplogroup 10 network (fig. 5) is much simpler, because of the smaller number of chromosomes, but again reveals population-specific clustering for Burusho and Hazara haplotypes. The haplogroup 28 network (fig. 6) shows a striking isolated Parsi-specific cluster, at the end of a long branch, containing 15 of 16 Parsi haplogroup 28 chromosomes. Clusters of Kalash, Burusho, and—to a lesser degree—Baluch chromosomes are also evident, although one Baluch haplotype is shared with Sindhi and Makrani Baluch individuals from nearby southern populations.

Figure 4.

Median-joining network of haplogroup 1 individuals, based on their Y-STR haplotypes. Circles represent haplotypes and have an area proportional to frequency, except the circle designated 013+, which represents 13 Parsi individuals and has been reduced in size. Color represents the population of origin. STR differences are shown on the lines linking haplotypes.

Figure 5.

Median-joining network of haplogroup 10 individuals, based on their Y-STR haplotypes. Conventions used are as in figure 4.

Figure 6.

Median-joining network of haplogroup 28 individuals, based on their Y-STR haplotypes. Conventions used are as in figure 4, except that some STR differences are shown by colored lines to make a complex region of the network clearer.

BATWING TMRCAs were calculated for the haplogroup 28 network and for selected lineages within a number of haplogroups. The results are summarized in table 8.

Table 8.

BATWING Estimates of TMRCAs for Selected Lineages

Haplogroup	Lineage within Haplogroup	PopulationSubdivision	Mode TMRCA [95% CI](years)
28	Entire haplogroup	Yes	7,200 [4,400–14,000]
28	Entire haplogroup	No	6,900 [4,000–13,000]
28	Parsi-specific	No	1,800 [600–4,500]
1	Hazara-specific	No	400 [120–1,200]
10	Hazara-specific	No	100 [6–600]

Discussion

We have carried out the first extensive analysis of Y diversity within Pakistan, examining 34 markers in 718 male subjects from 12 populations. This allows us to compare Pakistani Y diversity with that previously reported in world populations, to investigate differences within Pakistan, and to evaluate some of the suggested population histories from a Y perspective.

Comparisons with Worldwide Data

In a worldwide comparison, Pakistani populations mostly cluster around a pooled South Asian sample and lie close to a Middle Eastern sample (fig. 2A). This finding is unsurprising, in part because the South Asian sample included 62 Pakistani individuals (i.e., 32% of 196 total) and in part because Y variation in many areas of the world is predominantly structured by geography, not by language or ethnic affiliation (Rosser et al. 2000; Zerjal et al. 2001). The greater genetic similarity of Pakistani populations to those in the west than to eastern populations is illustrated by the fact that four of the five frequent haplogroups in Pakistan (haplogroups 1, 2, 3, and 9, which together make up 79% of the total population) are also frequent in western Asia and Europe but not in China or Japan; conversely, the haplogroups that are frequent in East Asia (e.g., 4, 5, 10, 13, and 20) are rare or absent in Pakistan, forming only 2.5% of the total. If, as in some interpretations, an early exodus from Africa along the southern coast of Asia led to the first anatomically modern human populations in Pakistan, and these people carried the eastern haplogroups or their precursors, their Y chromosomes have now been largely replaced by subsequent migrations or gene flow; indeed, the representatives of the eastern haplogroups in Pakistan may be derived from modern back-migration, not from ancient survivors.

The fifth haplogroup that is common in Pakistan, haplogroup 28, differs from all the others in its distribution. Within Pakistan, it made up 14% of our sample and was present in all but two populations (both of which had very small sample sizes), so it is both common and widespread. Outside Pakistan and the nearby countries, however, it is rare. It has been reported in India (30%; present in 3/3 populations), Tajikistan (10%; present in 5/6 populations), and Uzbekistan (3%; present in 10/13 populations), but it is rare in Russia (0.4%; present in 1/6 populations) and the Caucasus (1.4%; present in 1/6 populations (Wells et al. 2001) and has not been found at all in China or Mongolia (unpublished observations). BATWING estimates of the TMRCA of the Pakistani haplogroup 28 chromosomes were ∼7,000 (4,000–14,000) years (table 8). Thus, within this time period, the Pakistani populations have diverged from a common ancestral population or have experienced considerable male gene flow between themselves or from a common source. Since the estimated age corresponds to the early Neolithic period, the spread of this lineage might be associated with the local expansion of farmers.

Comparisons within Pakistan

Haplogroup distributions in Pakistani populations, with the exception of the Hazara (discussed in the next section), are strikingly similar to one another (figs. 1 and 2), despite some notable linguistic differences. Indeed, the language isolate-speaking Burusho, the Dravidian-speaking Brahuis, and the Sino-Tibetan–speaking Baltis did not stand out from the other populations at all in the haplogroup analyses (table 2 and fig. 2), suggesting either that the linguistic differences arose after the common Y pattern was established or that there has been sufficient Y gene flow between populations to eliminate any initial differences. Yet a more detailed analysis of the Y haplotypes (e.g., figs. 3–6) reveals some distinct features of the Brahui and considerable population specificity; population-specific clusters of related haplotypes are commonly found in these networks. Such clusters will only be seen if populations are isolated from one another. It may be that a low degree of gene flow between populations over a long time is sufficient to result in similar haplogroup frequencies without producing many shared clusters.

Population-specific clusters of haplotypes are particularly evident in some populations. In the Hazaras, where the distinct haplogroup frequencies noted above are found, most chromosomes (19/23; 83%) fall into one of just two well-isolated clusters (figs. 4 and 5), whereas the Parsis, the Kalash, and the Burusho also show prominent clusters. The Hazaras, Parsis, and Kalash were the three populations showing the most significantly different population pairwise Φ_ST values. The high values of the Hazaras and Parsis can partly be accounted for by migration to Pakistan from other places, but a contributing factor is likely to be drift, either due to a limited number of founder lineages or occurring subsequently within small populations. Θ_k values (Ewens 1972) provide a way of comparing effective population sizes. Values based on the STRs for the Hazaras, Parsis, Kalash, and Burushos were 8.9, 77.5, 25.8, and 74.2, respectively, compared with a mean of 181.8 for the other populations with sample sizes >20. Effective population size for Y chromosomes can differ greatly from census population size, but it is notable that the Parsis and Kalash do have the smallest census sizes, one-hundredth or one-thousandth of most of those of the other populations (table 1), so these small census sizes may have been maintained for a long time. In summary, many features of the present Pakistani Y haplotype distributions can be accounted for by a shared ancestral gene pool, with limited gene flow between populations and drift in the smaller ones.

Insights into Population Origins

The suggested population origins (table 1) can now be considered in the light of these Y results. Information is provided by haplogroup frequencies, which can be used to produce admixture estimates, and these are easy to interpret if populations are large and isolated and the source populations have different frequencies. When these conditions are not met, the presence of distinct Y lineages can still be informative. The origins of the Parsis are well-documented (Nanavutty 1997) and thus provide a useful test case. They are followers of the Iranian prophet Zoroaster, who migrated to India after the collapse of the Sassanian empire in the 7th century a.d. They settled in 900 a.d. in Gujarat, India, where they were called the “Parsi” (meaning “from Iran”). Eventually they moved to Mumbai in India and Karachi in Pakistan, from where the present population was sampled (fig. 7). Their frequencies for haplogroups 3 (8%) and 9 (39%) do indeed resemble those in Iran more than those of their current neighbors in Pakistan. They show the lowest frequency for haplogroup 3 in Pakistan (apart from the Hazaras; fig. 1C). The mean for eight Iranian populations was 14% (n=401) (Quintana-Murci et al. 2001), whereas that for Pakistan, excluding the Parsis, was 36%. The corresponding figures for haplogroup 9 were 39% in the Parsis, 40% in Iran, and 15% in Pakistan excluding the Parsis. These figures lead to an admixture estimate of 100% from Iran (table 3). Given the small effective population size of the Parsis, the closeness of their match to the Iranian data may be fortuitous, and the presence of haplogroup 28 chromosomes at 18% (4% in Iran; Wells et al. 2001) suggests some gene flow from the surrounding populations. The TMRCA for the Parsi-specific cluster in the haplogroup 28 networks was 1,800 (600–4,500) years (table 8), consistent with the migration of a small number of lineages from Iran. Overall, these results demonstrate a close match between the historical records and the Y data, and thus suggest that the Y data will be useful when less historical information is available.

Figure 7.

Traditions of population origin supported by Y data. Solid arrows, movements also supported by historical data. Dashed arrows, movements also supported by oral traditions. Arrows indicate the country of origin or continent of origin (Negroid Makrani) but not the precise geographical location or route. Darker boundaries represent disputed borders.

The population that is genetically most distinct, the Hazaras, claims descent from Genghis Khan’s army; their name is derived from the Persian word “hazar,” meaning “thousand,” because troops were left behind in detachments of a thousand. Toward the end of the 19th century, some Hazaras moved from Afghanistan to the Khurram Valley in Pakistan, the source of the samples investigated here. Thus, their oral history identifies an origin in Mongolia and population bottlenecks ∼800 and ∼100 years ago. Of the two predominant Y haplogroups present in this population, haplogroup 1 is widespread in Pakistan, much of Asia, Europe, and the Americas, and so provides little information about the place of origin. Haplogroup 10, in contrast, is rare in most Pakistani populations (1.4%, when the Hazaras are excluded) but is common in East Asia, including Mongolia, where it makes up over half of the population (unpublished results). Admixture estimates (table 3) are consistent with a substantial contribution from Mongolia. BATWING analysis of the Hazara-specific haplotype clusters in haplogroups 1 and 10 suggested TMRCAs of 400 (120–1,200) and 100 (6–600) years (table 8), respectively. Thus, the genetic evidence is consistent with the oral tradition and, in view of its independent nature, provides strong support for it (fig. 7).

Some other suggested origins receive more limited support from the Y data. The Negroid Makrani, with a postulated origin in Africa, carry the highest frequency of haplogroup 8 chromosomes found in any Pakistani population, as noted elsewhere (Qamar et al. 1999). This haplogroup is largely confined to sub-Saharan Africa, where it constitutes about half of the population (Hammer et al. 2001) and can thus be regarded as a marker of African Y chromosomes. Nevertheless, it makes up only 9% of the Negroid Makrani sample, and haplogroup 28 (along with other typical Pakistani haplogroups) is present in this population. If the Y chromosomes were initially African (fig. 7), most have subsequently been replaced: the overall estimate of the African contribution is ∼12% (table 3).

The Balti are thought to have originated in Tibet, where the predominant haplogroups are 4 and 26. Neither was present in the sample from this study, providing no support for a Tibetan origin of the Y chromosome lineages and an admixture estimate of zero (table 3). However, this result must be interpreted with caution, because of the small sample size. Three populations have possible origins from the armies of Alexander the Great: the Burusho, the Kalash, and the Pathans. Modern Greeks show a moderately high frequency of haplogroup 21 (28%; Rosser et al. 2000), but this haplogroup was not seen in either the Burusho or the Kalash sample and was found in only 2% of the Pathans, whereas the local haplogroup 28 was present at 17%, 25%, and 13%, respectively. Greek-admixture estimates of 0% were obtained for the Burusho and the Pathans, but figures of 20%–40% were observed for the Kalash (table 3). In view of the absence of haplogroup 21, we ascribe this result either to drift in the frequencies of the other haplogroups, particularly haplogroups 2 and 1, or to the poor resolution of lineages within these haplogroups, resulting in distinct lineages being classified into the same paraphyletic haplogroups. Overall, no support for a Greek origin of their Y chromosomes was found, but this conclusion does require the assumption that modern Greeks are representative of Alexander’s armies. Two populations, the Kashmiris and the Pathans, also lay claim to a possible Jewish origin. Jewish populations commonly have a moderate frequency of haplogroup 21 (e.g., 20%) and a high frequency of haplogroup 9 (e.g., 36%; (Hammer et al. 2000). The frequencies of both of these haplogroups are low in the Kashmiris and Pathans, and haplogroup 28 is present at 13% in the Pathans, so no support for a Jewish origin is found, and the admixture estimate was 0% (table 3), although, again, this conclusion is limited both by the small sample size available from Kashmir and by the assumption that the modern samples are representative of ancient populations.

The suggested origin of the Baluch is in Syria. Syrians, like Iranians, are characterized by a low frequency of haplogroup 3 and a high frequency of haplogroup 9 (9% and 57%, respectively; Hammer et al. 2000), whereas the corresponding frequencies in the Baluch are 29% and 12%. This difference and the high frequency of haplogroup 28 in the Baluch (29%) make a predominantly Syrian origin for their Y chromosome unlikely, and the admixture estimate was 0% (table 3), although the 8% frequency for haplogroup 21, the highest identified in Pakistan thus far, does indicate some western contribution to their Y lineages. The Brahuis have a possible origin in West Asia (Hughes-Buller 1991) and it has been suggested that a spread of haplogroup 9 Y chromosomes was associated with the expansion of Dravidian-speaking farmers (Quintana-Murci et al. 2001). Brahuis have the highest frequency of haplogroup 9 chromosomes in Pakistan (28%) after the Parsis, providing some support for this hypothesis, but their higher frequency of haplogroup 3 (39%) is not typical of the Fertile Crescent (Quintana-Murci et al. 2001) and suggests a more complex origin, possibly with admixture from later migrations, such as those of Indo-Iranian speakers from the steppes of Central Asia and others from further east. This possibility is supported by the detection of low frequencies of haplogroups 10, 12, and 13 in the Brahuis, all rare in Pakistan and typical of East Asia, East and northern Asia, and Southeast Asia, respectively.

The failure to find a Y link with a suggested population of origin does not disprove a historical association, but it does demonstrate that the Y chromosomes derived from such historical events have been lost or replaced. Analyses of mitochondrial DNA and other loci would help to elucidate the population histories and would be particularly interesting in populations like the Negroid Makrani and the Balti, in which there is a contrast between the phenotype and the typical Pakistani Y haplotypes.