Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
qRT-PCR primer sequences and product length
| Gene | Forward primer | Reverse primer | Product length (bp) |
|---|---|---|---|
| TDP-43 (primer set 1) | gtgctcgtctccacggttac | ttctaccagccggacacctc | 98 |
| TDP-43 (primer set 2) | gacgatggtgtgactgcaaac | gcagctcatcctcagtcatgtcc | 113 |
| cdc-42 | ctgctggacaggaagattacg | ctcggacattctcgaatgaag | 111 |
| pmp-3 | gttcccgtgttcatcactcat | acaccgtcgagaagctgtaga | 115 |
| Y45F10D0.4 | gtcgcttcaaatcagttcagc | gttcttgtcaagtgatccgaca | 139 |
