Table S3.
Primers
| Oligo | Sequence | Characteristics | Origin |
| SFP237 | GGAATTCCATATGttgttaacagccttaaaaacag | NdeI; ATG | This study |
| SFP238 | TGAGGATCCTTATTTTTCGAACTGCGGGTGGCTCCAAGCGCCgcactgatcttcaccctc | BamHI; STOP Strep-tag | This study |
| SFP239 | GGAATTCCATatgatgaacgacgctttgacgag | NdeI | This study |
| SFP255 | GAAGATCTTTAaggctgttttctttgtgctgc | BglII; STOP | This study |
| SFP271 | GGAATTCCATatggctaaagaaaaattcg | NdeI | This study |
| SFP272 | GTCGGATccatactattactcagtg | BamHI | This study |
| SFP273 | cgagcgcggtatcGcaatctctactg | T63A | This study |
| SFP274 | cagtagagattgCgataccgcgctcg | T63A | This study |
| SFP286 | CATGCCATGGGCatgatgaacgacgctttgacgag | NcoI | This study |
| SFP296 | CTCGCTCGAGccatactattactcagtg | XhoI | This study |
| SFP311 | GGAAGATCTACATCATCATCATCATCATGGTatggctaaagaaaaattcg | BglII; His-tag | This study |
| SFP494 | ATTCCATATGgtggcgaaggcgaagttcc | NdeI | This study |
| SFP495 | CGCGGATCCcctacttgatgatcttgg | BamHI | This study |
| SFP506 | TGAGGATCCatgagcccccgagttggcgt | BamHI | This study |
| SFP507 | TAGTGTCGACTTAacgctgaccggacgaaaacgtgc | SalI; STOP | This study |
| SFP527 | cagcgcggtatcGccatcaacatcg | T64A | This study |
| SFP528 | cgatgttgatggCgataccgcgctg | T64A | This study |
| SFP656 | ggccctgtccttttaccaga | yfp qPCR F | This study |
| SFP657 | atgccatgtgtaatcccagca | yfp qPCR R | This study |
| SFP658 | gcgacatggtagacgacgaa | tuf qPCR F | This study |
| SFP659 | tcagcgtctccttcaagagc | tuf qPCR R | This study |
Homology sequences are shown in lowercase. Nonhomolog sequences are shown in uppercase and include restriction sites (in italic), STOP codons (underlined), tags (bold), and point mutations.