Skip to main content
. 2015 Jul 7;10(7):e0132325. doi: 10.1371/journal.pone.0132325

Table 1. Nucleotide sequence variability within the long control region (LCR) of human papillomavirus type 6 (HPV-6) molecular variants.

Number of samples HPV-6 LCRvariant 7320 7350 7520 7626 7631 7633 7681 7762 7875 7919 7978 16
2 6a-ref A G C T A A A C C A C G
1 6a-var1 · · · · · · · · · · · A
1 6a-var2 G · · · · · · · · · · ·
6 6vc-ref · T I1 · T I2 · G A C · ·
1 6vc-var1 · T I1 G T I2 · G A C · ·
1 6vc-var2 · T I1 · T I2 · G A C T ·
1 6vc-var3 · T I1 · T I2 G G A C · ·

Genomic positions containing specific mutations are indicated vertically across the top. Genomic positions without mutations compared to the HPV-6a-ref sequence (·), Insertions (I): I1 = TTATTGTATATCTTGTTACA; I2 = C nucleotide insertion.