Skip to main content
. 2004 Jun 23;4:11. doi: 10.1186/1471-2431-4-11

Table 2.

Sequences of oligonucleotide primers used for the amplification of HCMV genome

Primers Sequence (5-3)' Product Length (pb) Position in the gene References
IE tgaggataagcgggagatgt 242 1729–1748 Jiwa N et al. (1989)
actgaggcaagttctgcagt 1951–1970
gB Outer
accaccgcactgaggaatgtcag 150 1942–1966 Darlington et al. (1985)
tcaatcatgcgtttgaagaggta 2067–2091
inner
accaccgcactgaggaatgtcag 100 1967–1989
tcaatcatgcgtttgaagaggta 2066–2040
LA cacctgtcaccgctgctatatttgc 400 1967–1989 Demmler G et al. (1998)
caccacgcagcggcccttgatgttt 2066–2040