TABLE 1.
Thirty-six initially selected VNTR loci found with Tandem Repeat Finder and tandem repeat information
| Locus | Tandem repeat sequence | Repeat unit length (bp) | No. of TR in reference strain | No. of variantsa | Coding region (according to NCBI database) | Position | Reference strain | Commentd |
|---|---|---|---|---|---|---|---|---|
| V1 | TCTATCTTTGTATTATTAAGA | 21 | 9.4 | Hypothetical protein | 1370374–1370570 | NCTC11168 | No amplified product in most test strains | |
| V2b | AAAGAAAAAAAT | 12 | 5.9 | 5 | Noncoding | 44616–44690 | NCTC11168 | Variable in tandem repeat |
| V3 | TTTTAATAATATA | 13 | 3.7 | 0 | Noncoding | 1091732–1091783 | NCTC11168 | Invariable in tandem repeat |
| V4 | AAAGTAAAG | 9 | 3.3 | 2 | Hypothetical protein | 765323–765352 | NCTC11168 | Invariable in tandem repeate |
| V5 | CGATGCAAA | 9 | 3 | 0 | Lipoprotein thioredoxin | 1588706–1588732 | NCTC11168 | Invariable in tandem repeat |
| V6b | ATTAAT | 6 | 3 | 2 | ATP/GTP-binding protein | 1409281–1409298 | NCTC11168 | Variable in tandem repeat |
| V7 | TGAAAAAGAACTAAA | 15 | 2.8 | 0 | Noncoding | 1326362–1326403 | NCTC11168 | Invariable in tandem repeat |
| V8 | TTTTTATAGTTTTTACTT | 18 | 2.4 | 0 | Type I phosphodiesterase/nucleotide pyrophosphatase | 684675–684718 | NCTC11168 | Invariable in tandem repeat |
| V9 | GCTTTGCTTTTG | 12 | 2.3 | 0 | Prolipoprotein diacylglyceryl transferase | 371800–371826 | NCTC11168 | Invariable in tandem repeat |
| V10 | TTAAATTCAAGC | 12 | 2.1 | 0 | Fibronectin/fibrinogen-binding protein | 1281533–1281557 | NCTC11168 | Invariable in tandem repeat |
| V11b | TTAAACTAA | 9 | 2 | 2 | Secreted protease | 477740–477748 | NCTC11168 | Variable in tandem repeat |
| V12 | AAAAAAATT | 9 | 2 | Integral membrane protein | 934077–934085 | NCTC11168 | Not tested furtherg | |
| V13b | AAGAAAAAAAAATA | 14 | 3.6 | 5 | Noncoding | 730103–730152 | ICDCCJ07001c | Variable in tandem repeat |
| V14 | TTCTATCATTTTTATCATC | 18 | 3.1 | 4 | Membrane protein, putative | 1146381–1146435 | ICDCCJ07001 | Variable in tandem repeatf |
| V15 | TAAAATTCACA | 11 | 2.4 | 2 | Rhomboid family protein | 976742–976767 | ICDCCJ07001 | Invariable in tandem repeate |
| V16 | TTTTTGATAAAAT | 13 | 2.3 | Putative sugar transferase | 1402318–1402347 | ICDCCJ07001c | No amplified product in all test strains | |
| V17b | TTTTGGGAT | 9 | 3.4 | 2 | Noncoding | 651147–651177 | 81116 | Variable in tandem repeat |
| V18 | AGAATTTTTACT | 12 | 2.8 | 0 | Hypothetical protein | 164129–164161 | 81116 | Invariable in tandem repeat |
| V19b | AAAAAATAAAAAGAAAT | 17 | 2.7 | 2 | Noncoding | 921640–921686 | 81116 | Variable in tandem repeat |
| V20 | ATTTTCTTTTGAT | 13 | 2.6 | Hypothetical protein | 802080–802111 | 81116 | No amplified product in most of test strains | |
| V21 | TATTTTAAAA | 10 | 3.8 | Noncoding | 271296–271333 | 00-2544 | Not tested furtherf | |
| V22 | ATTTTCTTTTGAT | 13 | 2.6 | 0 | Hypothetical protein | 813683–813714 | 00-2544 | Invariable in tandem repeat |
| V23 | AAAAAAAGCTAGA | 13 | 2.5 | 0 | Noncoding | 916910–916940 | 00-2544 | Invariable in tandem repeat |
| V24 | AAAAATTCACA | 11 | 2.5 | Amidohydrolase | 589221–589248 | 00-2544 | No amplified product in all test strains | |
| V25 | TTTTCTTTGATT | 12 | 4.6 | 0 | Hypothetical protein | 796003–796057 | 81-176c | Invariable in tandem repeat |
| V26 | AAAGAGTTAAAT | 12 | 4.3 | 3 | Hypothetical protein | 71065–71115 | 81-176c | Invariable in tandem repeate |
| V27 | CAATTTTAACATTAT | 15 | 6.5 | 0 | Putative sugar transferase | 1373487–1373584 | IA3902 | Invariable in tandem repeat |
| V28 | CTTTTTATAAATATTAA | 17 | 3.3 | Noncoding | 245643–245698 | IA3902 | No amplified product in most of test strains | |
| V29 | AAAATCTTGCG | 11 | 2.7 | Sugar transferase | 1454132–1454161 | 00-2425c | No amplified product in all test strains | |
| V30 | TTTTAATAATATA | 13 | 3.7 | 0 | Copper-translocating P-type ATPase | 1212484–1212535 | RM1221c | Invariable in tandem repeat |
| V31 | ATAAATAAAAAT | 12 | 3.5 | hypothetical protein | 1066708–1066749 | RM1221c | No amplified product in most of test strains | |
| V32 | TAGCAACAAA | 10 | 3.2 | Hypothetical protein | 1039943–1039974 | RM1221c | No amplified product in most of test strains | |
| V33b | TTAAAAAAA | 9 | 3.2 | 2 | Rhomboid family protein | 934591–934619 | PT14c | Variable in tandem repeat |
| V34 | ATTATTTTTAA | 11 | 6.2 | Noncoding | 628827–628897 | doylei 269.97c | No amplified product in all test strains | |
| V35 | TTTTCCTTTAAAAACAAAGCT | 21 | 7.2 | Hypothetical protein | 655672–655822 | S3c | No amplified product in most of test strains | |
| V36 | TATAATAATTAAAAG | 15 | 3.7 | Putative integral membrane protein | 58087–58138 | M1c | No amplified product in most of test strains |
a
Number of different fragment size polymorphisms detected among 10 C. jejuni isolates tested.
b
Finally chosen for MLVA typing scheme.
c
Uniquely found in that strain among 12 complete genomes of C. jejuni in GenBank database.
d
Results are summarized under the results of different fragment size polymorphisms detected among 10 C. jejuni isolates tested.
e
Found variable in PCR product size.
f
Found variable in fragment sizes of the same number of TR, resulting in 4 fragment size variants. The sequencing data revealed that this locus was variable with 2 different patterns of TR.
g
No appropriate primers were found.