Table 2. Primers used to amplify the aprX and lipM gene by PCR.
Primer | Sequence (5′-3′) | Aplication |
---|---|---|
Apr-F | TTATGTCAAAAGTAAAAGAC | Amplification of aprX gene |
Apr-R | TCAGGCTACGATGTCACTG | Amplification of aprX gene |
APRX-F | ATT GGATCC AAAGCTATTGTATCTGCCGCG | Amplification of aprX gene and preparation for cloning in pQE-30Xa |
APRX-R | ATT GAGCTC TCAGGCTACGATGTCACTGGC | Amplification of aprX gene and preparation for cloning in pQE-30Xa |
Lip-F | ATGGGTRTSTTYGACTATAAAAACC | Amplification of lipM gene |
Lip-R | TTAACCGATCACAATCCCCTCC | Amplification of lipM gene |
LIPM-F | ATT GGATCC AACCTCGGTACCGAGGACTC | Amplification of lipM gene and preparation for cloning in pQE-30Xa |
LIPM-R | ATT GAGCTC TTAACCGATCACAATCCCCTCCC | Amplification of lipM gene and preparation for cloning in pQE-30Xa |
The introduced restriction sites BamHI and Sac I are underlined.