Table 4.
The miRNAs with significant differential expressions (p-value ≤ 0.05) between the B. napus transcriptomes derived from non- and drought stress conditions. The best matched miRNAs obtained from miRBase database and their potential target genes are also represented
| B. napus mature miRNA sequence | The best matched miRNA | Fold change (Log2) | Target gene | UPE* | Inhibition mechanism |
|---|---|---|---|---|---|
| AUGAUUAUGAUUAUGAUGAGG | ath-miR5658 | 2.37 | BAK1 | 8.098 | Translation |
| AAAGGGGGGGGGGGAAUUU | osa-miR2919 | 0.91 | ABA1 | 22.646 | Cleavage |
| UUCCACAACUUUCUUCAAGUC | Bna-miR396a | 0.91 | B-box zinc finger | 17.6 | Translation |
| UAGAAAAGACAAAUCUGUUUA | gma-miR1536 | 0.91 | AGL6, IAA16, RGLG2 | 13.749 | Cleavage |
| UUUCCCGGUAUUGGACUUGG | osa-miR435 | 0.91 | COL4 | 21.26 | Translation |
| UAAAUCAAGGAAAGAAGGGUU | gma-miR1509b | −2.85 | – | – | – |
* Maximum energy to unpair the target site. The less energy means the more possibility that small RNA is able to contact (and cleave) target mRNA