Extended Data Table 1. Summary of recursive intron lariats identified by directed RT-PCR and sequencing.

For each recursive lariats confirmed by RT-PCR and sequenced, the following information is provided: gene, segment, coordinate of the putative branchpiont, distance upstream of the 3′ splice the branch point is located, the sequence surrounding the branchpoint, whether the lariat intron is newly validated with respect to the total RNA analysis described in Supplementary Table 4a.

Gene	Segment	Coordinate of putative branchpoint	Distance upstream of 3′ splice site	Sequence surrounding bp	Identified in Total RNA-Seq Data
Sdc	segment3	2R:17299944	21	CATCTCACTCATAAATGTGTT	No
cpo	segment1	3R:13803044	34	AAGGTAACTAATATGATTTTT	Yes
cpo	segment2	3R:13815266	31	CCAAATGCTAATTTTATACTT	Yes
cpo	segment3	3R:13832619	37	AGCAATCATCTAACGATTCTC	Yes
bun	segment2	2L: 12458256	32	CAACATACTTACAGAACCTTT	No
CG7029	segment2	3R:18592273	55	GTTTGTGCTCACAGAGTCTGC	No
nuf	segment2	3L:14223246	29	ATATAGACTTATCAGTTCTCT	No
CG31637	segment2	2L:6525343	23	GAGTATTCTAACAAGTTTCTC	Yes
dally	segment1	3L:8843654	26	CTAAATCTGTGCTTAATTTCT	No
dally	segment2	3L:8855584	45	AATTTGCACCATCGCATAACT	Yes
dally	segment3	3L:8870223	29	ATCCAAGCTCATCTCCTCTTT	Yes
Mmp2	segment2	2R:5503040	33	TAGCATGCTGATATCATGTTT	No
osp	segment2	2L: 14656399	30	AACCAAACTAATTTTTCTACC	No
osp	segment1	2L:14677529	41	ACATCTTCTTACTAAATTATT	No