Skip to main content
PLOS One logoLink to PLOS One
. 2015 Aug 10;10(8):e0135196. doi: 10.1371/journal.pone.0135196

MADS-box Transcription Factor OsMADS25 Regulates Root Development through Affection of Nitrate Accumulation in Rice

Chunyan Yu 1, Yihua Liu 1, Aidong Zhang 1, Sha Su 1, An Yan 1, Linli Huang 1, Imran Ali 1, Yu Liu 2, Brian G Forde 3, Yinbo Gan 1,*
Editor: Jin-Song Zhang4
PMCID: PMC4530940  PMID: 26258667

Abstract

MADS-box transcription factors are vital regulators participating in plant growth and development process and the functions of most of them are still unknown. ANR1 was reported to play a key role in controlling lateral root development through nitrate signal in Arabidopsis. OsMADS25 is one of five ANR1-like genes in Oryza Sativa and belongs to the ANR1 clade. Here we have investigated the role of OsMADS25 in the plant’s responses to external nitrate in Oryza Sativa. Our results showed that OsMADS25 protein was found in the nucleus as well as in the cytoplasm. Over-expression of OsMADS25 significantly promoted lateral and primary root growth as well as shoot growth in a nitrate-dependent manner in Arabidopsis. OsMADS25 overexpression in transgenic rice resulted in significantly increased primary root length, lateral root number, lateral root length and shoot fresh weight in the presence of nitrate. Down-regulation of OsMADS25 in transgenic rice exhibited significantly reduced shoot and root growth in the presence of nitrate. Furthermore, over-expression of OsMADS25 in transgenic rice promoted nitrate accumulation and significantly increased the expressions of nitrate transporter genes at high rates of nitrate supply while down-regulation of OsMADS25 produced the opposite effect. Taken together, our findings suggest that OsMADS25 is a positive regulator control lateral and primary root development in rice.

Introduction

Nitrogen (N) is one of the essential macronutrients required by plants for normal growth and development and is frequently the major limiting factor for crop yields [1]. For higher plants the major source of N is usually in the form of nitrate (NO3 -) [2, 3]. One of the most important functions of NO3 - is to provide nitrogen for synthesis of amino acids and other forms of organic N [4]. In addition, NO3 - acts as a signal to regulate many metabolic and developmental processes such as transcription and translation, energy transfer, protein accumulation, cytokinin transport, seed germination, and plant growth and development [1, 58]. The NO3 - content of aerobic soils can vary markedly in time and space [2, 3, 9], requiring plants to evolve sophisticated signaling and transport processes to enable them to adjust to these variations.

Rice is one of the most important food crops and N deficiency is considered as an important limiting factor affecting its productivity [2, 3]. Although under flooded conditions rice mainly takes up N in the form of ammonium, NO3 - still contributes 15–40% of the total N absorbed by the rice crop [10, 11]. Furthermore, NO3 - enhances the uptake and assimilation of ammonium by rice plants [11]. In plants, NO3 - is mainly taken up by two mechanisms, namely the high affinity uptake system (HATS) and low affinity uptake system (LATS) [12]. It has been suggested that two families of membrane proteins, the nitrate transporter 1 /peptide transporter family (NRT1/PTR) and nitrate transporter 2 (NRT2), are involved in NO3 - uptake by plants [1214]. NRT1/PTR family is named unified NPF according to the phylogenetic relationship of these proteins [15]. NRT2 proteins are the high affinity nitrate transporters while most of the NPF family is low affinity nitrate [1619].

A properly developed root system is essential to ensure the optimum uptake of water and mineral nutrients by plants [20, 21]. As the key component of root system, lateral root (LR) initiation and development is affected by the combined actions of gene regulation, hormone and environmental signals such as light, water and nutrient [2225]. In Arabidopsis, the ANR1 and AtABF3 genes are reported to be involved in distinct NO3 - signaling pathways regulating LR development [26, 27]. AtNPF6.3 functions upstream of ANR1 in regulating LR elongation, apparently in its role as a NO3 - sensor [28, 29]. Exogenous application of NO3 - has been reported to affect the expression of ANR1, a MADS-box transcription factor in regulating LR numbers and LR elongation [26]. ANR1 expression is induced by nitrate deprivation and constitutive over-regulation of ANR1 in roots of transgenic Arabidopsis increases LR growth while having no direct effect on LR density or primary root growth [30, 31]. The root phenotype of the ANR1 overexpressing lines mainly depends on the presence of NO3 -, suggesting that there other components involve in NO3 --dependent signaling pathway.

Although NO3 - regulation of LR development has been extensively studied in Arabidopsis, little is known about this process in rice. miR444 has been reported to target four ANR1-like homologous genes (OsMADS23, OsMADS27a, OsMADS27b and OsMADS57) to regulate root development in rice [3236]. miR444a regulates the NO3 --signaling pathway in rice roots as well as regulating NO3 - accumulation and the response to phosphate starvation [37]. OsMADS25 is one of the five ANR1-like homologues in rice [32, 33]. Previous studies reported that the expression of OsMADS25 is significantly induced by NO3 -, salt and osmotic stress [38, 39]. It was also reported that OsMADS25 is active in the central cylinder of the root and respond to auxin treatment [39]. To gain further insight into the possible regulatory functions of OsMADS25 in control root development in rice, we have investigated its regulatory role in root development through NO3 - regulation.

Experimental Procedures

Plant material and growth conditions

Oryza sativa L. cv. Nipponbare was used as the wild type for both physiological and genetic transformation experiments. Rice sterilization, growth conditions and measurements were performed according to our previously reported study [38].

For NO3 - treatments, rice plants were grown in hydroponic culture or on Gelzan plates with modified 1/2 Murashige and Skoog salts in which KNO3 and NH4NO3 were replaced by KCl or KNO3 [37, 40]. To prepare cultures of different nitrate concentration, 0 mM KNO3, 0.2 mM KNO3 and 10 mM KNO3 were added to N-free medium [37].

For NH4 + treatments, rice seedlings were germinated and grown on Gelzan plates with modified 1/2 Murashige and Skoog salts in which KNO3 and NH4NO3 were replaced by KCl or NH4Cl, respectively. To prepare cultures of different ammonium concentration, 0 mM NH4Cl, 0.5 mM NH4Cl and 5 mM NH4Cl were added to N-free medium [41].

To examine the NO3 - response of overexpressing OsMADS25 lines in Arabidopsis, surface-sterilized seeds were sown in 10×10 cm rectangular Petri dishes on medium containing 1% agar, 0.6%(w/v) sucrose, 1/50×B5 salts and 1 mM KCl and 1 mM glutamine was used to replace the nitrogen source of KNO3 and (NH4)2SO4 [31]. 7-day-old seedlings were transferred to fresh plates containing (in addition to 1 mM glutamine): 0 mM KNO3, 0.2 mM KNO3, 2 mM KNO3 or 10 mM KNO3 as N source [31]. Images taken at growth intervals of 16 d (no NO3 -), 14 d (0.2 and 2 mM NO3 -), and 13 d (10 mM NO3 -) were used to analyze different root parameters [26, 31]. To investigate whether overexpression of OsMADS25 affected early seedling development, surface-sterilized seeds were sown in 10×10 cm rectangular Petri dishes including 0, 0.2, 2 or 10 mM KNO3 [31]. After 2 d at 4°C, the plates were kept vertically at 22°C under the 16 h-light/8 h-dark light regime. Primary root length and the length of the first lateral root emerged were determined from images taken at 6 d, 8 d, 10 d, 12 d and 14d after sowing.

Gene constructs and generation of transgenic plants

For the overexpression construct, a full-length OsMADS25 cDNA was PCR-amplified and digested with restriction enzymes Sal I and Sma I for cloning into the pSB130-actin-NOS vector (a generous gift of Jumin Tu, Zhejiang University, China). To construct the RNA interference (RNAi) vector, a 259-bp cDNA fragment of OsMADS25 was amplified and inserted into the BamH I and Kpn I sites (for the reverse insert) and the Sac I and Spe I sites (for the forward insert) in the pTCK303 vector [42]. These constructs were transformed into rice using Agrobacterium tumefaciens EHA105 as previously described [43]. All transgenic lines were first selected based on the expression level of OsMADS25 and further confirmed by their phenotype.

To construct 35S::OsMADS25 for transformation into Arabidopsis, the 684 bp of the ORF were amplified by PCR and digested with Sal I and Not I and cloned into pENTR-1A vector. Subsequently the construct was recombined into pH2GW7 using the Gateway ‘LR reaction’ [44]. The binary vector construct was introduced into Agrobacterium strain GV3101 and Arabidopsis Col-0 plants were transformed by employing the floral dip method [45].

For the OsMADS25::YFP fusion, the 684 bp of the ORF was amplified by PCR and introduced in frame, after the YFP reporter gene of the 35S-pCAMBIA1300-YFP vector (a generous gift of Jumin Tu, Zhejiang University, China). Then the prepared construct was introduced into Agrobacterium tumefaciens strain EHA105. The recombinant constructs and free YFP (under the control of the 35S promoter) were introduced into epidermal cells of tobacco (Nicotiana tabacum) leaves which expressed the red fluorescent protein (RFP)-H2B by agroinfiltration [46, 47], and the epithelial tissue was examined using a scanning confocal laser microscope (Zeiss LSM 510) with a filter set for YFP fluorescence (514 nm for excitation and 525 nm for emission) and for RFP-fusion proteins using 543 nm laser lines. Primers used in the assembly of these constructs are listed in Table 1.

Table 1. Primer sequences used in this study.

Primer name Sense primer (5'->3') Anti-sense primer (5'->3')
OsMADS25 CCAGCTCAAGCATGAAATCAA AAAGTTGCCTGTTGTTGTGGTGT
OsActin CTTCATAGGAATGGAAGCTGCGGGT CGACCACCTTGATCTTCATGCTGCT
OsMADS25-OE GCGGTCGACATGGGGAGAGGGAAGATTG GCGCCATGGTTATTCATCTTCAACTT
OsMADS25-Ri GCGACTAGTGGTACCAGAGGAAATCTCCAACTTCAC GCGGAGCTCGGATCCGCTTCTGGTAACTTGCTCACTT
OsMADS25-yfp GCGTCGACATGGGGAGAGGGAAGATTG CGAGCTCTTATTCATCTTCAACTTCTTTTTGAC
OsMADS25-AtOE GCGTCGACATGGGGAGAGGGAAGATTG TTGCGGCCGCTTATTCATCTTCAACTTCTTTTTGAC

qRT-PCR analysis

Total RNA was isolated using the RNAiso Plus reagent from rice roots and shoots according to the manufacturer’s instructions. The first-strand cDNA was synthesized using the Reverse Transcriptase M-MLV from 2 μg total RNA in a 25 μl reaction, and diluted 4-fold with RNase-free water. Quantitative real-time RT-PCR was performed using SYBR Premix Ex Taq II as described in previous study [38, 48]. Expression of OsActin (Os03g0718100) was used as a reference to normalize expression of the other genes. Three biological replicates were performed for each RT-PCR experiment. Primers used for qRT-PCR are listed in Table 1.

Measurement of tissue nitrate concentrations

Nitrate concentration was determined according to the method previously reported [37, 49]. Samples of root and shoot tissue (~2 g) were collected and immersed in 10 ml deionized water and heated at 100°C for 20 min. After cooling to room temperature, deionized water was added to the suspension to a 25 ml final volume. The suspension was centrifuged at 7000 g for 15 min and 0.1 ml supernatant was mixed with 0.4 ml 5% (w/v) salicylic acid in concentrated H2SO4. After 20 min at room temperature, 9.5 ml 8% (w/v) NaOH was added slowly into the mixture and after cooling again to room temperature and the absorbance of the samples was measured for absorbance readings at 410 nm wave length.

Statistics

The results were analyzed by means of ANOVA for significance by IBM SPSS Statistics 21. Student’s t-test was analyzed to evaluate the significant difference between treatments at the probability at either 5% (P<0.05 with significant level *) or at 1% (P<0.01 with significant level **) as we previously described [50, 51].

Results

Subcellular localization of OsMADS25

To investigate the intracellular localization of OsMADS25, its cDNA sequence was fused to the coding sequence of yellow fluorescent protein (YFP) under the control of the 35S promoter. The 35S:: YFP:: OsMADS25 construct and free YFP (under the control of the 35S promoter) alone were expressed in tobacco epidermal leaf cells which expressing RFP:H2B nuclear marker. The yellow fluorescent signals from the free YFP and YFP:: OsMADS25 were overlapped with the red fluorescent signal from the RFP-H2B (Fig 1). The confocal images in Fig 1, showed that fluorescence associated with expression of the YFP-OsMADS25 fusion protein was detected in both nucleus and cytoplasm.

Fig 1. Subcellular localization of OsMADS25 protein.

Fig 1

In the epidermal cells of Nicotiana benthamiana leaves expressing the RFP-fusion proteins, the YFP-OsMADS25 fusion protein and free YFP protein were transiently expressed. The bottom panels show the localization of YFP-OsMADS25 in tobacco epidermal cells in a transient assay, while upper panels show the localization of YFP as a control. Scale bars (20 μm) are shown. At least two individual experiments were performed for each combination with the similar results.

Effect of OsMADS25-overexpression on root development in Arabidopsis

Since OsMADS25 is not only closely related to ANR1 but is also inducible by nitrate [38, 39], we investigated its possible role in NO3 - regulation of root architecture, initially using Arabidopsis as a model system. We created 35S::OsMADS25 overexpression transgenic lines and selected three representative transgenic lines that showed significantly higher OsMADS25 expression level in comparison to wild type (Fig 2A). Seedlings of wild type Col-0 and OsMADS25-overexpressing lines (OE25-18, OE25-22 and OE25-23) were cultured on vertically orientated agar plates in the absence of NO3 - and when 7 d-old they were transferred to fresh plates containing a range of NO3 - concentrations. In addition to nitrate, 1 mM glutamine was also included in all treatments as a background N source so that N deficiency did not become a problem at the lower NO3 - concentrations. Because increasing NO3 - concentrations accelerate the rate of seedling development, we attempted to minimize this effect by the comparisons of root growth and branching by imaging the seedlings at 16 d after transfer (0 mM KNO3), 14 d (0.2 or 2 mM KNO3), 13 d (10 mM KNO3). In addition, LR length was expressed per unit primary root length to minimize effects that might arise from differences in the rate of PR growth [31]. The mean lengths of the Col-0 PRs (in cm ± SD) at the time of imaging were 5.82±0.69 (no NO3 -), 5.54±0.43 (0.2 mM NO3 -), 5.47±0.56 (2 mM NO3 -), 5.72±0.68 (10 mM NO3 -). In the absence of NO3 -, OsMADS25-overexpressing lines (OE25-18, OE25-22 and OE25-23) showed significantly increases in PR length and LR number but no significant effect on LR length per unit PR length (Figs 3A–3C and 4). In the presence of NO3 -, particularly at the higher concentrations (2 mM and 10 mM), overexpression of OsMADS25 showed much stronger significant increase in both LR number and LR length/unit PR length (over 150% at 10 mM NO3 -).

Fig 2. Relative expression levels of OsMADS25 in 35S::OsMADS25 lines (Arabidopsis), actin::OsMADS25 lines (rice) and Ri:OsMADS25 lines (rice).

Fig 2

(A) Seeds of 35S::OsMADS25 lines and the wild type were germinated and grown on MS medium for 10 d and the seedlings were transferred to the soil. After two-week growth, the rosette leaves were harvested, and the mRNA level of OsMADS25 was performed by real-time RT-PCR. TUB2 gene was used as a control. Error bars represent SD. (B) Two-week-old rice seedlings of both wild type and transgenic lines were grown hydroponically in complete nutrient solution were harvested. qRT-PCR was used to assay the abundance of OsMADS25 mRNA in extracts of root RNA and OsActin was used as the reference. A Student’s t-test was used to analyze the significant difference between treatments at the probability of 5% (* p< 0.05) or 1% (**, P< 0.01).

Fig 3. Effect of the NO3- supply on root growth of three OsMADS25-overexpressing Arabidopsis lines (OE25-18, OE25-22 and OE25-23).

Fig 3

Surface-sterilized seeds were sown in 10×10 cm rectangular Petri dishes on medium without nitrate and 7-d-old seedlings were transferred to fresh plates containing various concentrations of nitrate. Images were taken at different time intervals for measurement of root parameters. Errors indicate standard deviation (SD; n = 12). A Student’s t-test was employed to calculate the significant difference between treatments at the probability of 5% (* p< 0.05) or 1% (**, P< 0.01).

Fig 4. Images showing the phenotype of seedlings of Col-0 and the OsMADS25-overexpressing lines (OE25-18 and OE25-22) grown on vertical agar plates with different concentrations of nitrate.

Fig 4

Seeds were germinated and grown on vertical agar plates in the absence of NO3 -. 7-day-old seedlings were transferred to fresh plates consist of: 0 mM KNO3, 0.2 mM KNO3, 2 mM KNO3 or 10 mM KNO3 as N source. Images were taken at different time intervals for measurement of root parameters: 16 d (no NO3 -), 14 d (0.2 and 2 mM NO3 -), and 13 d (10 mM NO3 -).

Overexpression of OsMADS25 in Arabidopsis significantly increased shoot and root fresh weight in the presence and absence of NO3 -, but this positive effect was much stronger in the presence of NO3 - (Fig 3D and 3E).

To investigate whether OsMADS25 overexpression in Arabidopsis affected early seedling development, transgenic lines (OE25-18, OE25-22 and OE25-23) were germinated and grown on medium containing four different concentrations of nitrate. Primary root length and the first lateral root length were determined from images taken at different intervals after sowing. As shown in Fig 5, OsMADS25-overexpressing lines (OE25-18, OE25-22 and OE25-23) showed significantly greater PR length and the first LR length at the early seedling development stage in comparison to the wild type Col-0 control and this effect was significantly enhanced in the presence of nitrate.

Fig 5. Effect of the NO3- supply on early seedling development of three OsMADS25-overexpressing Arabidopsis lines (OE25-18, OE25-22 and OE25-23).

Fig 5

(A to D) The primary root length of Col-0 and OsMADS25-overexpressing Arabidopsis lines (OE25-18, OE25-22 and OE25-23) under four different concentrations of nitrate. (E to H) First LR length of Col-0 and OsMADS25-overexpressing Arabidopsis lines (OE25-18, OE25-22 and OE25-23) under four different concentrations of nitrate. First LR was the first lateral root that emerged and extended horizontally from the primary root. Errors indicate standard deviation (SD; n = 30). A Student’s t-test was used to calculate the significant difference between treatments at the probability of 5% (* p< 0.05) or 1% (**, P< 0.01).

OsMADS25 regulates root development through the NO3 - regulation in rice

Previous studies reported that the expression of OsMADS25 was significantly regulated by NH4 + [38], we further investigated whether OsMADS25 regulates primary and lateral root development in response to ammonium. We tested the effects of OsMADS25 overexpression and its RNAi lines on root architecture under different concentrations of ammonium in rice. As shown in Fig 6, the numbers or length of adventitious roots, the PR length and the numbers or length of lateral roots were not significantly affected by either up- or down-regulation of OsMADS25 in the presence or absence of ammonium in comparison to the control line.

Fig 6. Effect of the ammonium supply on root growth of the OsMADS25-overexpressing lines and OsMADS25-interferring lines.

Fig 6

The root phenotype of 7 d-old wild type and transgenic rice seedlings grown in 0.5 mM ammonium or 0 mM ammonium and 8 d-old seedlings grown in 5 mM ammonium was determined. OEOsMADS25-3 and OEOsMADS25-18 are two overexpressing lines and RiOsMADS25-3 and RiOsMADS25-4 are two RNAi lines. Errors indicate standard deviation (SD; n = 15–20). AR, adventitious root; LR, lateral root; PR, primary root; LR/PR length, LR length per unit PR length. A Student’s t-test was employed to calculate the significant difference between treatments at the probability of 5% (* p< 0.05) or 1% (**, P< 0.01).

Since OsMADS25 overexpression was able to promote LR growth and development in Arabidopsis (Fig 3), thus, we also want to know whether overexpression of OsMADS25 in rice would produce the similar effect. We created actin::OsMADS25 overexpression transgenic lines and obtained fifteen independent transgenic lines, from which we chose two representative transgenic lines (OEOsMADS25-3 and OEOsMADS25-18) and these two lines both showed significantly higher OsMADS25 expression levels compared to wild type (Fig 2B). We also generated sixteen OsMADS25-interrupting lines and chose two typical transgenic lines (RiOsMADS25-3 and RiOsMADS25-4) which significantly suppressed the expressions of OsMADS25 (Fig 2B). Homozygous seeds of overexpressing lines (OEOsMADS25-3 and OEOsMADS25-18) and RNAi lines (RiOsMADS25-3 and RiOsMADS25-4) and the wild type were germinated and grown on agar plates for 8 d on 10 mM NO3 or for 7 d on either 0.2 mM NO3 or no nitrate. As shown in Figs 7 and 8, the LR lengths (per unit PR length) of the OEOsMADS25-3 and OEOsMADS25-18 lines were significantly greater than those of the wild type, while those of RiOsMADS25-3 and RiOsMADS25-4 lines were significantly shorter under both high nitrate and low nitrate. The same effects, but on a smaller scale, were seen in the cases of PR length (about 10% increase and 15% decrease), LR number (about 20% increase and 20% decrease) and lateral root length (about 20% increase and 25% decrease) in the presence of nitrate, but the numbers or length of adventitious roots (AR) were not significantly affected by either up- or down-regulation of OsMADS25. No significant differences between wild type and transgenic lines were seen in the absence of nitrate. These results indicated that OsMADS25 positively regulates the primary and lateral root growth in NO3 --regulation pathway in rice.

Fig 7. Effect of OsMADS25 overexpression and its down-regulation by RNAi on rice root development.

Fig 7

The root phenotype of 7 d-old wild type and transgenic rice seedlings grown in 0.2 mM nitrate or zero nitrate and 8 d-old seedlings grown in 10 mM nitrate was determined. OEOsMADS25-3 and OEOsMADS25-18 are two overexpressing lines and RiOsMADS25-3 and RiOsMADS25-4 are two RNAi lines. Errors indicate standard deviation (SD; n = 15–30). AR, adventitious root; LR, lateral root; PR, primary root; LR/PR length, LR length per unit PR length. A Student’s t-test was employed to calculate the significant difference between treatments at the probability of 5% (* p< 0.05) or 1% (**, P< 0.01).

Fig 8. Images showing the phenotype of seedlings of wild type, the OsMADS25-overexpressing lines (OEOsMADS25-3 and OEOsMADS25-18) and OsMADS25-interferring lines (RiOsMADS25-3 and RiOsMADS25-4) grown under different concentrations of nitrate.

Fig 8

Seeds were germinated and grown on vertical agar plates in 0.2 mM nitrate or zero nitrate and 8 d-old seedlings grown in 10 mM nitrate.

Effect of OsMADS25 overexpression and its down-regulation by RNAi on nitrate accumulation and shoot growth in rice

To examine the effect of over-expressing and down-regulating the expression of OsMADS25 on nitrate content and plant growth, Homozygous seeds of both wild type and transgenic plants (OEOsMADS25-3, OEOsMADS25-18, RiOsMADS25-3 and RiOsMADS25-4) were germinated and seedlings grown hydroponically for 14 d in medium containing 0, 0.2 or 10 mM KNO3. As shown in Figs 9A and 10, in the presence of nitrate, both shoot and primary root growth in OEOsMADS25-3 and OEOsMADS25-18 plants were significantly increased compared with the wild type, while down-regulation of OsMADS25 produced the opposite effect. However, no significant differences were observed in these parameters in the absence of nitrate. As seen in Fig 9B, at 10 mM NO3 -, OsMADS25-overexpressing plants showed significantly higher nitrate content in the shoot and root while OsMADS25-interferringing plants produced significantly lower nitrate content in shoot and root than the wild plants. However, at 0.2 mM NO3 - supply, the nitrate content in the root not in the shoot of OsMADS25-overexpressing lines were significantly increased and nitrate content in root of OsMADS25 down-regulating plants was significantly decreased in comparison to the WT plants and there were no significant differences between these lines when nitrate was excluded from the medium.

Fig 9. Effect of overexpression and down-regulation of OsMADS25 on nitrate accumulation and expression of nitrate transporter genes in rice.

Fig 9

Rice seedlings were grown in hydroponic cultures at low (0.2 mM) and high (10 mM) rates of KNO3 supply for 14d. (A) Lengths of shoots and primary roots. Error bars indicate standard deviation (SD; n = 20). (B) Nitrate content of in shoots and roots of wild type, OsMADS25-overexpressed (OEOsMADS25-3 and OEOsMADS25-18) and OsMADS25-down-regulated plants (RiOsMADS25-3 and RiOsMADS25-4) grown in high (10 mM KNO3) and low (0.2 or 0 mM KNO3) nitrate concentration conditions. FW, fresh weight. Error bars indicate standard error (SD; n = 12). (C) Roots and shoots of 14-d-old rice seedlings grown on 10 mM KNO3 were collected and qRT-PCR reactions were performed. Expression was normalized to that of OsActin mRNA. Significant difference was analyzed at the probability of 5% (* p< 0.05) or 1% (**, P< 0.01) by student’s t- test. Error bars indicate standard deviation (SD; n = 12).

Fig 10. Images showing the phenotype of seedlings of wild type, the OsMADS25-overexpressing lines (OEOsMADS25-3 and OEOsMADS25-18) and OsMADS25-interferring lines (RiOsMADS25-3 and RiOsMADS25-4) grown under different concentrations of nitrate.

Fig 10

Rice seedlings were grown in hydroponic cultures at 0 mM, 0.2 mM and 10 mM KNO3 supply for 14d.

As the increased nitrate content in the OsMADS25-overexpressing lines and decreased nitrate accumulation in the OsMADS25-interfering plants under 10 mM KNO3, we investigated the expressions of four nitrate transporter genes. As shown in Fig 9C, the mRNA abundance of four nitrate transporter genes (OsNRT1;2, OsNRT2;1, OsNRT2;3a and OsNRT2;4) were significantly decreased in the both shoots and roots of RiOsMADS25-3 and RiOsMADS25-4 lines compared with the wild type, while over-expression of OsMADS25 significantly increased the gene expressions of these four transporters.

Discussion

OsMADS25 may regulate plant growth and development and nitrate accumulation through NO3 - signaling pathway

The ANR1 MADS box gene has previously been identified as having a key role in the regulation of LR development by external nitrate [26, 31]. Five ANR1-like genes have been identified in rice: OsMADS23, OsMADS25, OsMADS27, OsMADS57 and OsMADS61 [33]. Four of these (OsMADS23, OsMADS27a, OsMADS27b, and OsMADS57) are miR444a targets [32, 33, 35, 36], although only the first three of these are reported to be expressed in roots [37, 39]. It has been reported that miR444a acts as a negative regulator of the NO3 --signaling pathway to modify LR development, leading to the suggestion that it acts by controlling the expression of its ANR1-related targets in rice [37]. However the existence of additional targets of miR444a leaves open the possibility that other miR444a targets could be involved [35, 36]. In this study, we observed that overexpression of OsMADS25 significantly promoted LR and PR growth in rice seedlings at early developmental stages, while interference with OsMADS25 expression had the opposite effect and that these responses were strongest in the presence of nitrate (Fig 7). These findings are similar to what was observed in ANR1-overexpressing lines of Arabidopsis, except that ANR1 overexpression specifically affected the LRs. In addition, we also found that there were no significant differences between wild type and transgenic seedlings under various concentrations of ammonium in rice (Fig 6). Previous studies reported that nitrate could act as a nutrient source as well as a signal to regulate gene expression, plant growth and development [5, 37, 52]. There observations indicate that the effect of altered OsMADS25 expression on root architecture was not accounted for nutrient regulation but for nitrate signaling. These results confirmed that OsMADS25 is a key transcriptional factor that controls root growth and development in rice and Arabidopsis by NO3 -. Although miR444a-overexpression in rice affected adventitious root development [37], OsMADS25-overexpressing in rice had no significant effect on adventitious root development, which may indicate that they regulate rice root development in a different way (Fig 7).

In addition to its role in LR growth, the involvement of ANR1 in shoot growth and nitrate accumulation has been investigated in Arabidopsis [31]. Previous results showed that shoot fresh weight was increased in ANR1-overexpressing lines, with evidence that this was likely to be a secondary effect of the larger root system [31]. Here we found that both shoot and PR growth were decreased in OsMADS25-downregulated rice lines compared with the wild type (Fig 9) and that the RNAi lines showed a significant reduction in nitrate accumulations and in expressions of nitrate transporters (Fig 9). Previous studies have indicated that ANR1 acts as a positive regulator to promote the expression of the NRT2.1 - a high-affinity nitrate transporter in Arabidopsis [30]. Therefore it seems likely that OsMADS25 is also a positive regulator of nitrate accumulation in rice and that the nitrate content increases in shoot and root in the overexpressing line confirmed this role. In conclusion, this study characterized a novel MADS-box transcription factor OsMADS25, which plays a key role in regulation primary and lateral root development in rice. Overexpression of OsMADS25 significantly increased lateral and primary root growth in the presence of high (10 mM) or low concentration of nitrate (0.2 mM). These results suggested that OsMADS25 might positively regulate root and shoot development through NO3 --regulation pathway in rice. Furthermore, overexpression of OsMADS25 altered the expressions of nitrate transporter genes, thus leading to increase nitrate accumulation under 10 mM NO3 -. Further study will be needed to explore the molecular mechanism in details to explain the role of OsMADS25 in regulating shoot and root development through NO3 --signaling pathway.

Data Availability

All relevant data are within the paper.

Funding Statement

The research was supported by the International Scientific and Technological Cooperation Project of the Ministry of Science and Technology of China (grant number 2010DFA34430), China Postdoctoral Science Foundation (2014M561769), the National Program on Key Basic Research Project (973 Program, grant no. 2015CB150200) and PhD Programs Foundation of Ministry of Education of China (grant no. 20120101110079).

References

  • 1. Vidal EA, Gutiérrez RA. A systems view of nitrogen nutrient and metabolite responses in Arabidopsis . Curr Opin Plant Biol. 2008;11:521–529. 10.1016/j.pbi.2008.07.003. 10.1016/j.pbi.2008.07.003 [DOI] [PubMed] [Google Scholar]
  • 2. Robertson GP, Vitousek PM. Nitrogen in agriculture: balancing the cost of an essential resource. Annu Rev Environ Resour. 2009;34:97–125. 10.1146/annurev.environ.032108.105046 [DOI] [Google Scholar]
  • 3. Forde BG, Clarkson DT. Nitrate and ammonium nutrition of plants: physiological and molecular perspectives. Adv Bot Res. 1999;30:1–90. 10.1016/S0065-2296(08)60226-8. [DOI] [Google Scholar]
  • 4. Crawford NM. Nitrate: nutrient and signal for plant growth. Plant Cell. 1995;7:859–868. 10.1105/tpc.7.7.859 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Krouk G, Ruffel S, Gutiérrez RA, Gojon A, Crawford NM, Coruzzi GM, et al. A framework integrating plant growth with hormones and nutrients. Trends Plant Sci. 2011;16:178–182. 10.1016/j.tplants.2011.02.004. 10.1016/j.tplants.2011.02.004 [DOI] [PubMed] [Google Scholar]
  • 6. Alboresi A, Gestin C, Leydecker MT, Bedu M, Meyer C, Truong HN. Nitrate, a signal relieving seed dormancy in Arabidopsis . Plant Cell Environ. 2005;28:500–512. 10.1111/j.1365-3040.2005.01292.x [DOI] [PubMed] [Google Scholar]
  • 7. Mochizuki S, Jikumaru Y, Nakamura H, Koiwai H, Sasaki K, Kamiya Y, et al. Ubiquitin ligase EL5 maintains the viability of root meristems by influencing cytokinin-mediated nitrogen effects in rice. J Exp Bot. 2014;65:2307–2318. 10.1093/jxb/eru110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Prinsi B, Negri A, Pesaresi P, Cocucci M, Espen L. Evaluation of protein pattern changes in roots and leaves of Zea mays plants in response to nitrate availability by two-dimensional gel electrophoresis analysis. BMC Plant Biol. 2009;9:113 10.1186/1471-2229-9-113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Fan X, Shen Q, Ma Z, Zhu H, Yin X, Miller A. A comparison of nitrate transport in four different rice (Oryza sativa L.) cultivars. Sci China C Life Sci. 2005;48:897–911. [PubMed] [Google Scholar]
  • 10. Kirk GJD, Kronzucker HJ. The potential for nitrification and nitrate uptake in the rhizosphere of wetland plants: a modelling study. Ann Bot-london. 2005;96:639–646. 10.1093/aob/mci216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kronzucker HJ, Siddiqi MY, Glass ADM, Kirk GJD. Nitrate-ammonium synergism in rice. A subcellular flux analysis. Plant Physiol. 1999;119:1041–1046. 10.1104/pp.119.3.1041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Forde BG. The role of long-distance signalling in plant responses to nitrate and other nutrients. J Exp Bot. 2002;53:39–43. 10.1093/jexbot/53.366.39 [DOI] [PubMed] [Google Scholar]
  • 13. Orsel M, Krapp A, Daniel-Vedele F. Analysis of the NRT2 nitrate transporter family in Arabidopsis. Structure and gene expression. Plant Physiol. 2002;129:886–896. 10.1104/pp.005280 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Tsay Y-F, Chiu C-C, Tsai C-B, Ho C-H, Hsu P-K. Nitrate transporters and peptide transporters. Febs Lett. 2007;581:2290–2300. 10.1016/j.febslet.2007.04.047. [DOI] [PubMed] [Google Scholar]
  • 15. Léran S, Varala K, Boyer J-C, Chiurazzi M, Crawford N, Daniel-Vedele F, et al. A unified nomenclature of nitrate transporter 1/ peptide transporter family members in plants. Trends Plant Sci. 2014;19:5–9. 10.1016/j.tplants.2013.08.008. 10.1016/j.tplants.2013.08.008 [DOI] [PubMed] [Google Scholar]
  • 16. Cai C, Wang J-Y, Zhu Y-G, Shen Q-R, Li B, Tong Y-P, et al. Gene structure and expression of the high-affinity nitrate transport system in rice roots. J Integr Plant Biol. 2008;50:443–451. 10.1111/j.1744-7909.2008.00642.x [DOI] [PubMed] [Google Scholar]
  • 17. Bai H, Euring D, Volmer K, Janz D, Polle A. The nitrate transporter (NRT) gene family in poplar. PLoS One. 2013;8:e72126 10.1371/journal.pone.0072126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Gojon A, Krouk G, Perrine-Walker F, Laugier E. Nitrate transceptor(s) in plants. J Exp Bot. 2011;62:2299–2308. 10.1093/jxb/erq419 [DOI] [PubMed] [Google Scholar]
  • 19. Miller AJ, Shen Q, Xu G. Freeways in the plant: transporters for N, P and S and their regulation. Curr Opin Plant Biol. 2009;12:284–290. 10.1016/j.pbi.2009.04.010 [DOI] [PubMed] [Google Scholar]
  • 20. Fitter AH. An architectural approach to the comparative ecology of plant root systems. New Phytol. 1987;106:61–77. 10.1111/j.1469-8137.1987.tb04683.x [DOI] [Google Scholar]
  • 21. Hodge A, Berta G, Doussan C, Merchan F, Crespi M. Plant root growth, architecture and function. Plant Soil. 2009;321:153–187. 10.1007/s11104-009-9929-9 [DOI] [Google Scholar]
  • 22. Osmont KS, Sibout R, Hardtke CS. Hidden branches: developments in root system architecture. Annu Rev Plant Biol. 2007;58:93–113. 10.1146/annurev.arplant.58.032806.104006 . [DOI] [PubMed] [Google Scholar]
  • 23. Malamy JE. Intrinsic and environmental response pathways that regulate root system architecture. Plant Cell Environ. 2005;28:67–77. 10.1111/j.1365-3040.2005.01306.x [DOI] [PubMed] [Google Scholar]
  • 24. Walch-Liu P, Ivanov I, FilleurI S, Gan Y, Remans T, Forde BG. Nitrogen regulation of root branching. Ann Bot-london. 2006;97:875–881. 10.1093/aob/mcj601 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Desnos T. Root branching responses to phosphate and nitrate. Curr Opin Plant Biol. 2008;11:82–87. 10.1016/j.pbi.2007.10.003. [DOI] [PubMed] [Google Scholar]
  • 26. Zhang H, Forde BG. An Arabidopsis MADS box gene that controls nutrient-induced changes in root architecture. Science. 1998;279:407–409. 10.1126/science.279.5349.407 [DOI] [PubMed] [Google Scholar]
  • 27. Vidal EA, Araus V, Lu C, Parry G, Green PJ, Coruzzi GM, et al. Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in Arabidopsis thaliana . Proc Natl Acad Sci U S A. 2010;107:4477–4482. 10.1073/pnas.0909571107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ho C-H, Lin S-H, Hu H-C, Tsay Y-F. CHL1 Functions as a nitrate sensor in plants. Cell. 2009;138:1184–1194. 10.1016/j.cell.2009.07.004 [DOI] [PubMed] [Google Scholar]
  • 29. Zhang H, Jennings A, Barlow PW, Forde BG. Dual pathways for regulation of root branching by nitrate. Proc Natl Acad Sci U S A. 1999;96:6529–6534. 10.1073/pnas.96.11.6529 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Gan Y, Filleur S, Rahman A, Gotensparre S, Forde BG. Nutritional regulation of ANR1 and other root-expressed MADS-box genes in Arabidopsis thaliana . Planta. 2005;222:730–742. 10.1007/s00425-005-0020-3 [DOI] [PubMed] [Google Scholar]
  • 31. Gan Y, Bernreiter A, Filleur S, Abram B, Forde BG. Overexpressing the ANR1 MADS-Box gene in transgenic plants provides new insights into its role in the nitrate regulation of root development. Plant Cell Physiol. 2012;53:1003–1016. 10.1093/pcp/pcs050 [DOI] [PubMed] [Google Scholar]
  • 32. Lee S, Kim J, Son J-S, Nam J, Jeong D-H, Lee K, et al. Systematic reverse genetic screening of T-DNA tagged genes in rice for functional genomic analyses: MADS-box genes as a test case. Plant Cell Physiol. 2003;44:1403–1411. 10.1093/pcp/pcg156 [DOI] [PubMed] [Google Scholar]
  • 33. Arora R, Agarwal P, Ray S, Singh A, Singh V, Tyagi AK, et al. MADS-box gene family in rice: genome-wide identification, organization and expression profiling during reproductive development and stress. BMC Genomics. 2007;8:242 10.1186/1471-2164-8-242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Meng Y, Shao C, Wang H, Ma X, Chen M. Construction of gene regulatory networks mediated by vegetative and reproductive stage-specific small RNAs in rice (Oryza sativa). New Phytol. 2013;197:441–453. 10.1111/nph.12018 [DOI] [PubMed] [Google Scholar]
  • 35. Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y. Rice microRNA effector complexes and targets. Plant Cell. 2009;21:3421–3435. 10.1105/tpc.109.070938 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Li Y-F, Zheng Y, Addo-Quaye C, Zhang L, Saini A, Jagadeeswaran G, et al. Transcriptome-wide identification of microRNA targets in rice. Plant J. 2010;62:742–759. 10.1111/j.1365-313X.2010.04187.x [DOI] [PubMed] [Google Scholar]
  • 37. Yan Y, Wang H, Hamera S, Chen X, Fang R. miR444a has multiple functions in the rice nitrate-signaling pathway. Plant J. 2014;78:44–55. 10.1111/tpj.12446 [DOI] [PubMed] [Google Scholar]
  • 38. Yu C, Su S, Xu Y, Zhao Y, Yan A, Huang L, et al. The effects of fluctuations in the nutrient supply on the expression of five members of the AGL17 clade of MADS-Box genes in rice. PLoS One. 2014;9:e105597 10.1371/journal.pone.0105597 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Puig J, Meynard D, Khong GN, Pauluzzi G, Guiderdoni E, Gantet P. Analysis of the expression of the AGL17-like clade of MADS-box transcription factors in rice. Gene Expr Patterns. 2013;13:160–170. 10.1016/j.gep.2013.02.004. 10.1016/j.gep.2013.02.004 [DOI] [PubMed] [Google Scholar]
  • 40. Murashige T, Skoog F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum. 1962;15:473–497. 10.1111/j.1399-3054.1962.tb08052.x [DOI] [Google Scholar]
  • 41. Fang Z, Xia K, Yang X, Grotemeyer MS, Meier S, Rentsch D, et al. Altered expression of the PTR/NRT1 homologue OsPTR9 affects nitrogen utilization efficiency, growth and grain yield in rice. Plant Biotechnol J. 2013;11:446–458. 10.1111/pbi.12031 [DOI] [PubMed] [Google Scholar]
  • 42. Wang Z, Chen C, Xu Y, Jiang R, Han Y, Xu Z, et al. A practical vector for efficient knockdown of gene expression in rice (Oryza sativa L.). Plant Mol Biol Rep. 2004;22:409–417. 10.1007/BF02772683 [DOI] [Google Scholar]
  • 43. Hiei Y, Ohta S, Komari T, Kumashiro T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 1994;6:271–282. 10.1046/j.1365-313X.1994.6020271.x [DOI] [PubMed] [Google Scholar]
  • 44. Yan A, Wu M, Yan L, Hu R, Ali I, Gan Y. AtEXP2 is involved in seed germination and abiotic stress response in Arabidopsis . PLoS One. 2014;9:e85208 10.1371/journal.pone.0085208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana . Plant J. 1998;16:735–743. 10.1046/j.1365-313x.1998.00343.x [DOI] [PubMed] [Google Scholar]
  • 46. Zhang J, Zou D, Li Y, Sun X, Wang N-N, Gong S-Y, et al. GhMPK17, a cotton mitogen-activated protein kinase, is involved in plant response to high salinity and osmotic stresses and ABA signaling. PLoS One. 2014;9:e95642 10.1371/journal.pone.0095642 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Martin K, Kopperud K, Chakrabarty R, Banerjee R, Brooks R, Goodin MM. Transient expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition of protein localization, movement and interactions in planta . Plant J. 2009;59:150–162. 10.1111/j.1365-313X.2009.03850.x [DOI] [PubMed] [Google Scholar]
  • 48. Zhou Z, Sun L, Zhao Y, An L, Yan A, Meng X, et al. Zinc finger protein 6 (ZFP6) regulates trichome initiation by integrating gibberellin and cytokinin signaling in Arabidopsis thaliana . New Phytol. 2013;198:699–708. 10.1111/nph.12211 [DOI] [PubMed] [Google Scholar]
  • 49. Cataldo DA, Maroon M, Schrader LE, Youngs VL. Rapid colorimetric determination of nitrate in plant tissue by nitration of salicylic acid 1. Commun Soil Sci Plan. 1975;6:71–80. 10.1080/00103627509366547 [DOI] [Google Scholar]
  • 50. SUN L-l, ZHOU Z-j, AN L-j, AN Y, ZHAO Y-q, MENG X-f, et al. GIS regulates trichome branching by genetically interacting with SIM in Arabidopsis . J Zhejiang Univ Sci B. 2013;14:563–569. 10.1631/jzus.B1200349 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Bao S, An L, Su S, Zhou Z, Gan Y. Expression patterns of nitrate, phosphate, and sulfate transporters in Arabidopsis roots exposed to different nutritional regimes. Botany. 2011;89:647–653. 10.1139/b11-053 [DOI] [Google Scholar]
  • 52. Léran S, Edel KH, Pervent M, Hashimoto K, Corratgé-Faillie C, Offenborn JN, et al. Nitrate sensing and uptake in Arabidopsis are enhanced by ABI2, a phosphatase inactivated by the stress hormone abscisic acid. 2015;8:ra43 10.1126/scisignal.aaa4829 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES