Table 1.

The command options of HMPL Part I (Pre.HMPL.pl).

OPTIONS	EXPLANATION
[−1<file>]	Required. FASTQ format single-end input file or pair-end input file 1, eg, −1 MCF7.fastq, which is the file name of a fastq dataset.
[−2<file>]	FASTQ format pair-end input file 2. By default, when there is no input 2, it only processes the input file 1 and processes it as a single-end file.
[-o <dir>]	The output directory. The default output directory is the user’s current directory. For example, if the current directory in which the user runs HMPL is ‘/home/user/check.folder/’, then when running HMPL command line without specifying ‘-o’, the user would have all the output files in ‘/home/user/check.folder’.
[-p <string>]	Required. The prefix written to the output file names. eg, –p MCF7, then the output file will have the prefix MCF7 (eg, MCF7.site, or MCF7.cluster).
[-r <file>]	The name of the file that lists the genome reference sequence (ie, *.fa) files that users will use to do alignment. Please note that this “-r” option must be provided whether or not the “-I” (ie, alignment index) option is provided. Otherwise, the “acgt-count” function in the BRAT-bw package will not generate proper output files. For example, we set it as “-r/home/reference/hg19/hg19.fa.filename.txt” This “hg19.fa.filename.txt” may include the following lines that show the location of the fasta files for chromosomes 10 and 11 (or other chromosomes) as shown below: /home/projects/data/reference/hg19/chr10.fa/home/projects/data/reference/hg19/chr11.fa
[-f <sanger or illumine>]	FASTQ format: HMPL accepts sanger or illumina format FASTQ files as input data; default is sanger.
[-a <yes or no>]	Adapter trimming: Users can select whether or not to utilize cutadapt for adapter trimming (default is no adapter trimming).
[-A <tirng>]	Adapter sequences: HMPL accepts two adapter sequence inputs, separated by a comma, and default is AGATCGGAAGAGCGGTTCAGCAG GAATGCCGAG, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT.
[-T <fix or brat>]	Quality trim flag: Specifies whether to use BRAT dynamic trimming function (default is BRAT-trim) or the user can specify ‘fix’ to apply fixed quality trimming (ie, trim off a fixed number of bases).
[-N <int>]	Fixed quality trimming: Specifies the number of bases to be trimmed at the 5′ end (default is 5).
[-n <int>]	Fixed quality trimming: Specifies the number of bases to be trimmed at the 3′ end (default is 10).
[-Q <yes or no>]	Whether or not to do the quality assessment using FastQC (default is no).
[-I <dir>]	The index directory for BRAT-bw alignment. If the index folder is provided, it will be automatically used. Otherwise, it will build index, which is the default setting.
[-i <positive integer>]	To specify minimum insert size for paired-end mapping, the minimum distance allowed between the left-most ends of the mapped mates on the forward strand (default is 0).
[-m <positive integer>]	To specify maximum insert size for paired-end mapping, the maximum distance allowed between the left-most ends of the mapped mates on the forward strand (default is 1000).