Table 1.

Primer pairs employed to amplify chicken cytoplasmic beta-actin (actb), beta-2 microglobulin (β₂m), glyceraldehyde 3-phosphate dehydrogenase (gapdh) and tata-binding protein (tbp) gene fragments, which were evaluated here as reference sequences for qPCR normalisation.

Target gene	Primer identity	Sequence (5′ to 3′)	Theoretical annealing temperature (°C)	Amplicon size (bp)	Primer references	GenBank accession nos. for locus	Primer location (from 5′ end)	Gene references
actb	Forward — actbF	GAGAAATTGTGCGTGACATCA	60	152	[58]	X00182	3003–3023	[41]
	Reverse — actbR	CCTGAACCTCTCATTGCCA	60				3136–3154
β2m	Forward — b2mF	GCAAACCTCTGTCTTTCGGC	60	126	this study	Z48922	3191–3210	[42]
	Reverse — b2mR	ATGTTCAGACCAGAGCCTGC	60				3297–3316
gapdh	Forward — GAPDH_For1	CGCAAGGGCTAGGACGG	60	98	[59]	M11213	220–236	[43]
	Reverse — GAPDH_Rev1	GCGCTCTTGCGGGTACC	60				301–317
tbp	Forward — tbpF	TAGCCCGATGATGCCGTAT	62	147	[58]	NM_205103	144–162	[44]
	Reverse — tbpR	GTTCCCTGTGTCGCTTGC	60				273–290