Skip to main content
. 2015 Aug 14;5:52. doi: 10.1186/s13568-015-0139-y

Fig. 3.

Fig. 3

Confirmation of the loss of pSLT. Agarose gel (0.9 %) with PCR products to confirm curing of virulence plasmid. Lanes 1, 2 and 3 are reactions performed with strain MHM21 before plasmid curing; the strain cured of pSLT was used as a template in lanes 4, 5 and 6. Lanes 1 and 4 contain PCR products targeting chromosomal gene phoN (amplified using TCATTTGCTGTGGCCAGTT and TTATTGCCTGATCCGGAGTG; lanes 2 and 5 contain PCR product stargeting spvA::[I-SecI site, cat] with CAGAATGGTCTGCTGCTCAC and GGATTTCATTCTGTTTATTTTCAGG; and lanes 3 and 6 contain PCR products targeting plasmid gene repA (with primers GGCTATAGAGTGCGGTCTGG and TCCGTGCAGTTTACGTTCAG).