Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
The gene sequences of the primers.
| ID | Primer name | Sequence (5′ to 3′) | Base number |
|---|---|---|---|
| gi|392350511|ref|XM_003750630.1| | TLR2-domain | CCCAAGCACACTCACTCAACT | 20 |
| gi|189011593|ref|NM_001127555.1| | IRAK-1 | CAAGGAGGCACTACCAGAGAAT | 22 |
| gi|158508715|ref|NM_053355.2| | IKK-β | CCAAGAGACCAAAGGACAGAAG | 22 |
