Table 1. Bacterial strains and plasmids used in this study.
| Strain or plasmid | Properties | Reference |
|---|---|---|
| S. diastaticus var. 108 | Wild-type (WT); CE-108 and rimocidin producer. | [19] |
| S. diastaticus var. 108/PM1-709B | WT derivative with rimJ disrupted by integration of PM1-709B. | This work |
| S. diastaticus var. 108::PM1-709B/860 | WT derivative with rimJ disrupted by integration of PM1-709B and transformed with pSM860. | This work |
| S. diastaticus var. 108/780 | WT derivative by transformation with pSM780. CE-108 and rimocidin producer. | This work |
| S. diastaticus var. 108/781 | WT derivative by transformation with pSM781. Rimocidin producer as majority polyene. | This work |
| S. lividans TK21 | General cloning host | [37] |
| S. lividans TK21/pSM858 | S. lividans TK21 WT derivative transformed with pSM858 plasmid | [32] |
| E. coli JM101 | General cloning host | [38] |
| Penicillium chrysogenum ATCC10003 | Antifungal activity assays | ATCC |
| Aspergillus niger ATCC1004 | Antifungal activity assays | ATCC |
| Issatchenkia orientalis CECT 1688 | Antifungal activity assays | CECT |
| Filobasidiella neoformans CECT 1078 | Antifungal activity assays | CECT |
| PM1-709B | 1.8 kb XhoI-BglII fragment from pGAe-1 [16] carrying the ermE gene and 840 bp BamHI-SacI internal fragment of rimJ cloned into the XhoI/SacI sites of PM1 phage [40]. | This work |
| pSM859 | HindIII-EcoRI fragment from pSM858 (carrying oriT and pcsA under the control of ermE P*) cloned into the HindIII/EcoRI sites of pIJ2925 [37]. | This work |
| pSM860 | BglII-EcoRI fragment from pSM859 (carrying oriT and pcsA under the control of ermE P*) cloned into the BamHI/EcoRI sites of pIJ922 [42]. | This work |
| pSM780 | pHJL401 [41] derived vector carrying the ermE P* promoter from pIJ4090 [37] and oriT. | [32] |
| pSM781 | 17,866–16,005 bp fragment from the sequence deposited under accession number AY442225 isolated as BamHI present in the oligonucleotide CCR-D (CGGGATCCCGCCTTTTCCGGAGGC, 17849–17866 bp from AY442225) and Ecl136II of the chromosome cloned into the BamHI-Ecl136II sites of pSM780. This plasmid carries rimJ under the control of the ermE P* promoter. | This work |
ermE P*: constitutive erythromycin-resistance promoter where the asterisk signifies the presence of a one-base-pair mutation [43].