Skip to main content
. 2015 Aug 12;34(1):81. doi: 10.1186/s13046-015-0199-5

Table 1.

Real Time PCR primers used for the detection of HERVs. The accession, region, sequence, polarity and product size for the primers used are reflected

Symbol Accession Region Forward Reverse Size (bp)
18S NR003286 1025-1513 tcaagaacgaaagtcggagg ggacatctaagggcatcaca 488
HERV-WE1 AF072506 290-463 gggttccatggttctcttct tggtgaaccacttccaagat 174
HERV-FRD1 NM207582 504-698 ctcattctcacgccttcact taattccgcctctatgcttg 195
HERV-V1 NM152473 1565-1757 gggcaaagattctgcaacta ttgtctggctacctgcctac 193
HERV-31 NM001007253 1377-1562 taaccagaaattgcctgagc gaagaggcggttagtgtgaa 186