Table 1. Polymerase chain reaction (PCR)-based assays used for genetic characterization of Brookwood and Caldbeck Culex pipiens lines.

Assay	PCR Reaction Mix	PCR Conditions
COI Barcode assay [41]	Reaction volume of 25μl: 2.5μl nuclease-free water (Qiagen, UK); 12.5μl Qiagen TopTaq Master Mix (Qiagen, UK); 2.5μl CoralLoad Concentrate (Qiagen, UK); 1.25μl of the 10μM forward primer LCO1490 (5’-GGTCAACAAATCATAAAGATATTGG-3’); 1.25μl of the 10μM reverse primer HCO2198 (5’-TAAACTTCAGGGTGACCAAAAAATCA-3’); 5.0μl of template DNA per reaction.	Denaturation at 94°C for three minutes; 35 cycles 94°C for 30 seconds; 46°C for 30 seconds; 72°C for one minute. Final extension step 72°C for ten minutes.
Eurasia ace-2 multiplex assay [42]	Reaction volume of 10μl: 0.4μl nuclease-free water (Qiagen, UK); 5.0μl Qiagen TopTaq Master Mix (Qiagen, UK); 0.2μl 25mM Magnesium Chloride (MgCL2) (Qiagen, UK); 1.0μl CoralLoad Concentrate (Qiagen, UK); 0.1μl of 10μM forward primer ACEtorr (5’- TGCCTGTGCTACCAGTGATGTT -3’; 0.1μl of 10μM forward primer ACEpip (5’- GGAAACAACGACGTATGTACT -3’; 0.2μl of 10μM reverse primer B1246s (5’-TGGAGCCTCCTCTTCACGG-3’; 3.0μl of template DNA per reaction.	Denaturation at 94°C for three minutes; 35 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 72°C for one minute. Final extension step 72°C for ten minutes.
CQ11 microsatellite assay [22]	Reaction volume of 20μl: 0.80μl nuclease-free water (Qiagen, UK); 10.0μl Qiagen TopTaq Master Mix (Qiagen, UK); 0.4μl 25mM Magnesium Chloride (MgCL2) (Qiagen, UK); 0.15μl 20mg/ml Bovine Serum Albumin (Sigma-Aldrich Company Ltd, UK); 2.0μl CoralLoad Concentrate (Qiagen, UK); 0.15μl of 10μM forward primer CQ11F (5’- GATCCTAGCAAGCGAGAAC-3’; 0.20μl of 10μM reverse primer pipCQ11R (5’- CATGTTGAGCTTCGGTGAA -3’; 0.30μl of 10μM reverse primer molCQ11R (5’-CCCTCCAGTAAGGTATCAAC-3’; 6.0μl of template DNA per reaction.	Denaturation 95°C for three minutes; 40 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 72°C for one minute. Final extension step at 72°C for ten minutes.