Skip to main content
. 2015 Aug 4;112(33):10539–10544. doi: 10.1073/pnas.1419791112

Table S2.

The physical position of polymorphisms in ChFLC differentiating Ox from Wa

Position Pos.gene Size Ox Wa
−1,840 Promoter 0 A G
−1,783 Promoter 0 G A
−1,691 Promoter 0 A T
−1,671 Promoter 0 A C
−1,614 Promoter 45 TTAATATGTAAAATCAAACTTAGAACATTCAGAGATGCCTCTGAA
−1,584 Promoter 0 T A
−1,583 Promoter 0 T A
−1,523 Promoter 0 T A
−1,499 Promoter 0 C T
−1,305 Promoter 0 G A
−1,198 Promoter 0 A T
−1,085 Promoter −1 T
−1,077 Promoter 0 T G
−1,021 Promoter 0 C A
−1,008 Promoter −1 T
203 First intron 0 A C
530 First intron 0 G T
2,445 First intron 0 G A
4,186 Sixth intron 0 T A
4,482 Sixth intron −1 A
4,658 Sixth intron 0 G T
4,689 Sixth intron 0 T G
4,771 Sixth intron 0 C A