Table 3.

Forms and numbers of indel mutation events in the plastome between the two Machilus species.

No.	Location	region	Motif	Size	Driectiona
1	trnH-psbA	Intergenic	aaaacaaaatgttgtacataaa	22	Deletion
2	rps16-trnQ	Intergenic	cttgta	6	Deletion
3	trnG	Intron	c	1	Insertion
4	trnG	Intron	tga	3	Deletion
5	atpF	Intron	tg	2	Deletion
6	psbM-trnD	Intergenic	tacatggaccaggagcaatcg	21	Insertion
7	trnE-trnT	Intergenic	taatt	5	Insertion
8	ycf3-trnS	Intergenic	tgtat	5	Deletion
9	trnS-rps4	Intergenic	g	1	Deletion
10	trnS-rps4	Intergenic	aagag	5	Insertion
11	ndhC-trnV	Intergenic	attaaat	7	Deletion
12	ndhC-trnV	Intergenic	a	1	Deletion
13	trnV	Intron	t	1	Deletion
14	ycf4-cemA	Intergenic	ttctat	6	Insertion
15	rpl16	Intron	ggat	4	Deletion
16	rpl2-rpl2	Intergenic	tc	2	Insertion
17	ycf1-ndhF	Intergenic	a	1	Deletion
18	ndhF	Exon	ttcgaa	6	Insertion
19	ndhF-rpl32	Intergenic	aatcaagatatacaagatataaaagaact caaatatgatttttcattcttaattattctgatt ctttccaaactattgaaaaaaaaaaaaaaac	94	Deletion
20	ndhF-rpl32	Intergenic	t	1	Deletion
21	rpl32-trnL	Intergenic	g	1	Deletion
22	rps15-ycf1	Intergenic	a	1	Deletion
23	rpl23-rpl2	Intergenic	ag	2	Insertion
24	atpF-atpH	Intergenic	c	1	Insertion
25	ycf3-trnS	Intergenic	a	1	Insertion
26	ndhC-trnV	Intergenic	a	1	Insertion
27	rpl32-trnL	Intergenic	t	1	Deletion
28	rbcL-accD	Intergenic	t	1	Insertion
29	rbcL-accD	Intergenic	t	1	Insertion

^aThe plastome of M. yunnanensis was used as a reference.