Table 1.
Primers designed for the isolation of the PSY gene of P. tricornutum (Primer Numbers 1 and 2), for the construction of the transformation vector (3–8), for the genomic PCR analysis (3 and 9) and for the qRT-PCR analysis (10–15).
| Primer Number | Name | Sequence (5′–3′) | Annotation |
|---|---|---|---|
| 1 | PtPSY-(attB4r)F | ggggacaacttttctatacaaagttgctATGAAAGTTTCGACAAAGCTCTG | add att to 5′ terminal of Ptpsy |
| 2 | PtPSY-(Gx5)R | tccacctccgcctccTACTTGATCCAATTGGACC | add Gx5 linker to 3′ terminal of Ptpsy |
| 3 | PtfcpA Pro-(attB1)F | ggggacaagtttgtacaaaaaagcaggcttaGGGCTGCAGGACGCAATGGAG | add att to 5′ terminal of PtfcpA promoter |
| 4 | PtfcpA Pro-(attB4)R | ggggacaactttgtatagaaaagttgggtgTCTCGAAACGGCAGACAA | add att to 3′ terminal of PtfcpA promoter |
| 5 | CffcpTer/F/attB3 | ggggacaactttgtataataaagttgTGCGGCCGCATTGCTTGTTG | add att to 5′ terminal of CffcpA terminator |
| 6 | CffcpTer/R/attB2 | ggggaccactttgtacaagaaagctgggtGAGCTCTGGAAGCAT | add att to 3′ terminal of CffcpA terminator |
| 7 | EGFP-(Gx5)F | ggaggcggaggtggaATGGTGAGCAAGGGCGAGGAGCT | add Gx5 linker to 5′ terminal of egfp |
| 8 | EGFP-(B3r)R | ggggacaactttattatacaaagttgtTTACTTGTACAGCTCGTCC | add att to 3′ terminal of egfp |
| 9 | EGFP(qPCR)-R | CACGAACTCCAGCAGGACCA | used for genomic PCR analysis |
| 10 | PtPSY(qPCR)-F | ATGTTTGGTGTCGACGAACG | detect endogenous and introduced psy |
| 11 | PtPSY(qPCR)-R | TTGCCACAAACGCTCCAATC | detect endogenous and introduced psy |
| 12 | PtPSY-Gx5-EGFP(qPCR)-F | GGACGCAAGACATTTCTCAATGG | detect introduced psy |
| 13 | PtPSY-Gx5-EGFP(qPCR)-R | TCGCCCTTGCTCACCATTC | detect introduced psy |
| 14 | Q-rps-fw | CGAAGTCAACCAGGAAACCAA | detect rps |
| 15 | Q-rps-rv | GTGCAAGAGACCGGACATACC | detect rps |
Additional att and Gx5 linker sequences for the construction of the transformation vector are shown in lowercase.